5 apos 3 apos deletion analysis and site directed mutation assay

... 0.02/12 ± 0 .5 4. 45 ± 0. 05/ stableb 2. 93 ± 0.02/stableb + phosphatea 5. 2 (3. 45 3 .55 2.27 ± ± ± ± 0.2c/stableb,c 0.03d/stableb,d) 0.02d/stableb,d 0.02d/ 43 ± 5d a Potassium phosphate and ammonium ... mM Cm at 30 °C (M)/t1/2 at 45 °C (min) Enzyme KdSO4 (mM)/KdPi (mM) No oxyanion added + sulfatea Wild-type 4 .5 ± 0 .5/ 18 ± 1.17 ± 0. 03/ 3.2 ± 0.1 2. 95 ± 0.10/stableb R 234 A R242A ± 3/ n.a 3. 8 ± 0.4/n.a ... underlined: 5 -ATCGAAGCC GAGCGCGTTTCC -3 (R 234 A); 5 -GAACGCGAGGCC GTTTCC -3 (R 236 A); and 5 -GATATCTGCGCCGT GCTC -3 (R242A) A 1400-bp fragment of the StP gene, obtained by digestion of pQE 30 -StP with...

Ngày tải lên: 31/03/2014, 01:20

... (Wang, 19 93) Based on the SMR, SAR and SNR determined for each stand, study stands were stratified into site groups: C, F, G, I, J, K and L as delineated and labelled by Wang (19 93) Each site group ... with site classification Unlike previous studies that used both site unit and site index in developing height curves (eg Carmean, 1 956 ; Beck and Trousdell, 19 73; Carmean and Kok, 1974; Losch and ... 119- 154 Rayner ME, Turner BJ (1990) Growth and yield modelling of Australia eucalyptus forests I Historical development Australia For 53 , 224- 237 Greene WH British Columbia For Sci 35 , 50 - 63 Inions...

Ngày tải lên: 08/08/2014, 19:21

... 5 -CTTTCCAGTAAGCGCTGGAATATTG CATG -3 ; C176S: 5 -GGATATTGGCAGCGGCTGGG GCGGACTGGC -3 and 5 -GCCAGTCCGCCCCAGCC GCTGCCAATATCC -3 ; C 35 4 S: 5 -CTGAATGCCTCT GCAGGTGCTTTCCGCGCC -3 and 5 -GGCGCGCGG AAAGCACCTGCAGAGGCATTCAG -3 Plasmid ... Natl Acad Sci USA 87, 1 937 1941 Ploux, O., Lei, Y., Vatanen, K & Liu, H.-W (19 95) Mechanistic studies on CDP-6-deoxy-D -3, 4-glucoseen reductase: The role of 33 34 35 36 37 38 39 40 cysteine residues ... (min)1ặmM)1) eciency (%) Wild type 90 C 139 S 88 C176S 73 C 35 4 S 1 05 2.2 0 .3 2.7 1.6 24.8 3. 9 37 .9 15. 7 100 16 150 63 three corresponding Cys Ser mutants for analysis This particular replacement was chosen...

Ngày tải lên: 07/03/2014, 16:20

... Wild-type C 257 A C213S/G 152 Q C170A C 132 A C20A H17A H86A S87A* D216A* H244A* 36 46 33 34 .5 108 ND 2 73 ND ND ND ND 32 .4 21 .5 22 .5 4.9 8.1 ND 0.2 0.024 ND ND ND 146.7 122 .5 98 .56 20 .58 73. 0 ND 5. 75 ND ND ... assay conditions for its formation, the product was isolated and analysed by MS EI-MS data were m/z (%): 36 6 (37 , M+), 3 65 (37 , M+-1), 3 35 (17, M+-CH2OH), 249 [71, 3 65- C(CH2OH)CO2CH2CH3], 2 35 ... positions 2 13, 257 and 170 C213S and C 257 A showed almost 33 % loss in their specific activities; for C170A this decreased to 85% The models (Fig 4) show ˚ how closely Cys2 13 is located to Asp216 (5. 8 A),...

Ngày tải lên: 24/03/2014, 04:21

... 5 -GGTACAGTTACATGAACAATGATGTTTTGGCC -3 5 -GGCCAAAACATCATTGTTCATGTAACTGTACC -3 21 F-ERG25seq2 R-ERG25seq2 F-ERG25seq3 R-ERG25seq3 F-ERG25seq4 R-ERG25seq4 F-ERG25seqA R-ERG25seqA F-ERG25seqB R-ERG25seqB F-ERG25seqC R-ERG25seqC ... 97SQS/∆AUS1 on YPD + 5% Human serum 54 3. 15 Candida glabrata 97SQS and 97SQS/∆AUS1 on YPD + 10% Human serum .55 3. 16 Candida glabrata 97SQS and 97SQS/∆AUS1 on YPD + 5% Bovine serum 56 3. 17 Candida glabrata ... Figure Page 3. 12 Candida glabrata 97SQS and 97SQS/∆AUS1 on YPD + 1X Cholesterol .52 3. 13 Candida glabrata 97SQS and 97SQS/∆AUS1 on YPD + 3X Cholesterol . 53 3. 14 Candida glabrata 97SQS and 97SQS/∆AUS1...

Ngày tải lên: 24/08/2014, 12:11

Ngày tải lên: 07/08/2014, 10:20

... box Yes to save the mesh Create a static analysis and give it a name Choose the default options when defining the analysis Click File -> New Static 13 Convergence Method Convergence gives you ... Quick Check Define and run an analysis using the quick check convergence option With this option, the engine runs the analysis at a polynomial order of You can then check stress and deformation ... shown below 30 Run the analysis of model with the same material, load, and constraints Be sure to submit the following information with your report: • Model with Elements, Loads, and Constraints...

Ngày tải lên: 12/12/2013, 12:15

... binding site, which did not per se FEBS Journal 272 (20 05) 1 756 –1766 ª 20 05 FEBS D Tropel and J R van der Meer A HbpR-binding site Combining mutations in the distal and the proximal site very ... transcriptional enhancers and enhancer-binding proteins Trends Biochem Sci 16, 39 7–402 FEBS Journal 272 (20 05) 1 756 –1766 ª 20 05 FEBS HbpR-binding site 11 Morett E & Segovia L (19 93) The r54 bacterial enhancer-binding ... Genes Dev 17, 255 2– 256 3 18 Schumacher J, Zhang X, Jones S, Bordes P & Buck M (2004) ATP-dependent transcriptional activation by bacterial PspF AAA+ protein J Mol Biol 33 8, 8 63 8 75 19 Tropel D...

Ngày tải lên: 07/03/2014, 17:20

... polarized (5. 5 ± 0 .3 pM and 5. 1 ± 0.2 pM bound 125I-labelled d-ACTX-Hv1a or 125I-labelled Lqh-II, respectively) and depolarized synaptosomes pretreated at 37 °C for 30 (3. 8 ± 0.6 pM and 0. 75 ± 0. 15 pM, ... kon (106 0 .57 ± 0.20 (n ¼ 3) 6 .5 ± 1.4 (n ¼ 4) 0.18 ± 0.04 (n ¼ 3) 5. 85 ± 0 .5 (n ¼ 4) 1.84 ± 0.2 (n ¼ 3) 0. 43 ± 0. 13 (n ¼ 3) 12.0 ± 4.0 (n ¼ 6) 0. 25 ± 0. 03 (n ¼ 4) )1 )1 M Æs ) koff (10 3 s)1) 1.1 ... the radiotoxin and by estimation of its biological activity as described previously ( [36 ], usually 60–70% for 125I-labelled LqhaIT and 35 55 % for 125I-labelled d-ACTX-Hv1a) 125I-labelled LqhaIT...

Ngày tải lên: 08/03/2014, 16:20

... 0.00 031 2.0 3. 7 1.7 1.7 0 .50 2.8 1 .5 1.9 0.17 0.00 13 0.00087 0.00 0 53 0.00 057 0.0 134 0.000 25 0.00016 3. 3 1.40 0.0 233 0.0186 0.00061 1.49 0.0220 0.0 032 0.49 1.60 0. 25 0.68 1 . 53 2 .3 0.26 1 .31 6.7 ... 0.1 45 0.01 35 0.00061 0.000082 0. 051 0.0092 0.00067 0. 45 1.48 1.7 2 .5 3. 1 1.61 6.0 2 .3 2.4 0.098 0.0079 0.00024 0.000026 0. 032 1 0.00 15 0.00029 0. 35 0.0 050 0.00014 0.000 93 0.0002 85 0. 037 7 0.00 038 ... can identify 12 different Sfbgly50 active sites Six of these mutants – the wild-type enzyme (Q39E 451 ) and five mutants (E39E 451 , N39E 451 , Q39D 451 , Q39N 451 and Q39S 451 ) – had already been characterized,...

Ngày tải lên: 16/03/2014, 18:20

... (5 TAAACCARAGGGTGCGGCAYTGGA -3 ), K54VR (5 TCCARTGCCGCACCCTYTGGTTTA -3 ), R55AF (5 -CA AAGGAAGGCGCACTGGAA -3 ), R55AR (5 -TTCCAG TGCGCCTTCCTTTG -3 ), R55KF (5 -CAAAGGAAGAA GCACTGGAA -3 ) and R55KR (5 -TTCCAGTGCTTCT TCCTTTG -3 ) ... MALN1 and MALC Mutants I50K, K54V, R55A and R55K were constructed in a similar way, using oligonucleotides I50KF I50KR (5 -CAACTGGTTCAAAAACCAAAGGAA -3 ), (5 -TTCCTTTGGTTTTTGAACCAGTTG -3 ), K54VF (5 TAAACCARAGGGTGCGGCAYTGGA -3 ), ... J Biol Chem 2 73, 132 73 132 79 52 Sedmak J & Grossberg S (1977) A rapid, sensitive, and versatile assay for protein using Coomassie brilliant blue G- 250 Anal Biochem 79, 54 4 55 2 53 Dixon WJ, Hayes...

Ngày tải lên: 23/03/2014, 13:20

... Conclusion 23 23 23 26 32 34 37 39 PART II 41 SITE SELECTION AND PROGRAMMING CHAPTER SITE SELECTION Introduction Site Selection Scope The Site Selection Process Conclusion 43 43 45 47 66 v vi ... Approvals Conclusion 2 95 2 95 296 3 05 30 7 30 8 31 6 Appendix 32 9 Glossary 33 7 References 34 7 Index 35 7 vii Preface CONTEXT A context-sensitive approach to sustainable planning and development helps to protect ... and, when appropriate, in time 13 14 Site Analysis Figure 1 -5 Site planning and design process Site Inventory (Physical) Programming Site Inventory (Biological) Site Analysis Conceptual Design Design...

Ngày tải lên: 12/06/2014, 08:53

... Fig 32 Estimated voltage harmonics for V 35 36 Power Quality Harmonics Analysis and Real Measurements Data Fig 33 Estimated fundamental current IA Fig 34 Harmonics magnitude of IA against time ... v  t   1cos t  10   0.1cos  3 t  20   0.08 cos  5 t  30    0.08 cos  9t  40  0.06 cos  11t  50    0.05cos  13 t  60   0.03cos  19t  70  The data window size ... frequency of 8 .5 kHz A computer program was written to change this sampling rate in the analysis Figs 31 and 32 show the recursive estimation of the magnitude of the fundamental, second, third and fourth...

Ngày tải lên: 19/06/2014, 08:20

... Customer P (W) Customer 228 264 34 8 38 4 -0 .52 -1.14 -1. 05 -6 .34 0.09 0.07 0.08 0 .58 -3 . 53 0. 13 -1.98 - 23 .5 0.72 -0. 75 -0.14 3. 64 Table Active Power Results for the Feeder and Customers 6.2 The VIH-IIH ... (W) 0.1 -0.1 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 -0.2 -0 .3 Customer Customer -0.4 Customer -0 .5 Time Step Fig 13 Active power at the loads for fIH = 264Hz 34 8 Hz 0.2 Customer ... 28 31 34 37 40 43 46 49 52 55 58 61 64 67 -1 -1 .5 -2 -2 .5 Time Step Fig 12 Active power at the loads for fIH = 228Hz 82 Power Quality Harmonics Analysis and Real Measurements Data 264 Hz 0 .3 0.2...

Ngày tải lên: 19/06/2014, 08:20

... (mm) σmax (MPa) Δz (mm) Szb 177 149 1 75 150 30 0 Shm Sn Szb Shm Sn Case 157 255 184 196 282 28 234 36 73 157 256 1 83 1 93 282 10 30 2 25 35 75 1 65 3 75 600 33 0 750 0 0 L=8t Bi=6.97 L=4t Bi=2.16 Table ... 11.7 , 0.99 , 0.27 , 0.24 , 0 .39 4t, 2.16, 22.41, 2.48 , 9. 03 , 0 .50 , 0.28 , 0 .30 , 0. 43 S∝1/L for βL 5 0.6 0 .5 Sn,max 0.4 b/β=0 .5 1 .5 20 50 b/β=1 b/β=10 30 b/β>100 0 .3 0.2 0.1 0 βL Fig 12 The maximum ... 50 Heat Analysis and Thermodynamic Effects S∝1/L for βL 5 Szb,max 0 .3 b/β=0 .5 1 .5 b/β>20 0.2 b/β=1 b/β=10 0.1 0 βL Fig The maximum bending stress 0 .5 b/β=1 1 .5 b/β=10 b/β>20 1 .5 Location...

Ngày tải lên: 19/06/2014, 10:20

... 0.2 050 0 0.2 050 0 0.2 050 0 0.2 050 0 0.2 050 0 0.2 050 0 1 .52 400 1 .52 400 1 .52 400 1 .52 400 1 .52 400 1 .52 400 1 .52 400 Dotl 0.1 73 25 0.1 73 25 0.1 73 25 0.1 73 25 0.1 73 25 0.1 73 25 0.1 73 25 0.1 73 25 0.1 73 25 1.4 730 0 ... 0.0 254 0 arr 1 1 1 1 1 2 2 pt 0.0 237 9 0.0 237 9 0.0 237 9 0.0 237 9 0.0 237 9 0.0 254 0 0.0 254 0 0.0 254 0 0.0 254 0 0. 031 75 0. 031 75 0. 031 75 0. 031 75 0. 031 75 0. 031 75 0. 031 75 Ntp 8 Table Tube counting table ... 1.4 730 0 1.4 730 0 1.4 730 0 1.4 730 0 1.4 730 0 1.4 730 0 1.4 730 0 dex 0.019 05 0.019 05 0.019 05 0.019 05 0.019 05 0.019 05 0.019 05 0.019 05 0.019 05 0.0 254 0 0.0 254 0 0.0 254 0 0.0 254 0 0.0 254 0 0.0 254 0 0.0 254 0 arr...

Ngày tải lên: 19/06/2014, 10:20

... Monitoring, Analysis and Enhancement Akagi, H., Kanazawa, Y., Nabae, A (19 83) Generalized Theory of the Instantaneous Reactive Power in Three-Phase Circuits, IEEE – IPEC 83, (19 83) , pp 13 75- 138 6, Tokio, ... pp 34 4- 35 0 , 1998, ISSN 08 85- 8977 Emanuel, A (1990) Powers in nonsinusoidal situations: A Review of Definitions and Physical Meaning IEEE Trans On Power Delivery, vol 5, No 3, (July 1990), pp 137 7- ... (November 1999), pp 152 6- 1 53 2, ISSN 08 85- 8 950 Gunther, E., McGranaghan, M (2002) Power Measurement in Distorted and Unbalanced Condition – An Overview of IEEE Trial-Use Standard 1 459 -2000 Power Engineering...

Ngày tải lên: 19/06/2014, 11:20

... Neurocomputing, Vol 73, (2009), pp 3 15 32 3 Rilling, G.; Flandrin, P.; Gonçalvés, P (20 03) .ON Empirical mode decomposition and its algorithm (20 03) IEEE-EURA SIP Workshop on Nonlinear Signal and Image Processing ... S (20 05) A Chirp-Z transform-based synchronizer for power system measurements, IEEE Transaction on Instrument Measurement, Vol 54 , No 3, (20 05) , pp 10 25 1 032 ATPDraw for Windows 3. 1x/ 95/ NT version ... Vol.27, No.8, (August 20 05) , pp 1226-1 238 Pinnega, C.R.; Mansinha L.; The S -transform with windows of arbitrary and varying shape Geophysics, Vol 68, (20 03) , pp 38 1 3 85 Proceedings of the Workshop...

Ngày tải lên: 19/06/2014, 11:20

... 0. 15 -0 .5 0.2 0. 25 0 .5 0. 75 0. 05 -0.01 10 15 10 15 10 -0. 05 0. 75 15 u [N] z3 [m] 0.01 0 .5 t [s] 0.1 -0.02 0. 25 t [s] 0.02 z1 [m] x 10 3 .5 D1 2 .5 1 .5 0 .5 -0 .5 N1 -7 x 10 -5 -0.1 t [s] 10 15 -10 ... opt γ ζ θ = 5% opt ζT opt γ opt opt ζT λ = 0 .5% 0.9 951 0.0282 0.99 35 0.02 83 0.99 15 0.02 83 0.9 832 0.02 83 λ = 1% 0.99 03 0. 039 8 0.9881 0. 039 8 0.9 856 0. 039 8 0.9 755 0. 039 8 λ = 1 .5% 0.9 855 0.0487 0.9829 ... responses and identification of frequency for f (t) = sin (8.0109t) [N] -5 2 .5 2 .5 -6 x 10 12 x 10 D2 N2 2 1 .5 F0e 1 .5 0 .5 0 .5 0 0. 05 0.1 t [s] 0. 15 0.2 -0 .5 0. 25 0 .5 0. 75 t [s] -4 0. 25 0 .5 0. 75 t [s]...

Ngày tải lên: 19/06/2014, 19:20

... Structural Control and Health Monitoring, Vol. 15, pp 34 9 36 8, ISSN 154 5-22 63 Pavic, A & Willford, M (20 05) Appendix G in Post-tensioned concrete floors design handbook– Technical Report 43, Concrete ... Digest, Vol. 35 , No .5, pp 34 7– 65, ISSN 058 3- 1024 Hanagan, L.M (20 05) Active floor vibration system, United States Patent 6874748 Moutinho, C., Cunha, A & Caetano, E (2010) Analysis and control ... large space structures, Journal of Guidance and Control, Vol.2, No .3, pp 252 53 Bolton, W (1998) Control engineering, Logman, ISBN 978-0 -58 2 -32 7 73- 3, United Kingdom Brownjohn, J.M.W., Pavic,...

Ngày tải lên: 19/06/2014, 19:20