Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Potential active-site residues in polyneuridine aldehyde esterase,a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis Emine Mattern-Dogru1, Xueya

Potential active-site residues in polyneuridine aldehyde esterase,

a central enzyme of indole alkaloid biosynthesis, by modelling

and site-directed mutagenesis

Emine Mattern-Dogru1, Xueyan Ma1, Joachim Hartmann2, Heinz Decker2and Joachim Sto¨ckigt1

1

Lehrstuhl fu¨r Pharmazeutische Biologie, Institut fu¨r Pharmazie, Johannes Gutenberg-Universita¨t Mainz, Germany,

2 Lehrstuhl fu¨r Molekulare Biophysik, Johannes Gutenberg-Universita¨t Mainz, Germany

In the biosynthesis of the antiarrhythmic alkaloid ajmaline,

polyneuridine aldehyde esterase (PNAE) catalyses a central

reaction by transforming polyneuridine aldehyde into

epi-vellosimine, which is the immediate precursor for the

syn-thesis of the ajmalane skeleton The PNAE cDNA was

previously heterologously expressed in E coli Sequence

alignments indicated that PNAE has a 43% identity to a

hydroxynitrile lyase from Hevea brasiliensis, which is a

member of the a/b hydrolase superfamily The catalytic

tri-ad, which is typical for this family, is conserved By

site-directed mutagenesis, the members of the catalytic triad were

identified For further detection of the active residues, a

model of PNAE was constructed based on the X-ray crys-tallographic structure of hydroxynitrile lyase The potential active site residues were selected on this model, and were mutated in order to better understand the relationship of PNAE with the a/b hydrolases, and as well its mechanism of action The results showed that PNAE is a novel member of the a/b hydrolase enzyme superfamily

Keywords: polyneuridine aldehyde esterase; active-site resi-dues; site-directed mutagenesis; modelling; a/b hydrolase enzyme superfamily

Polyneuridine aldehyde esterase (PNAE, EC 3.1.1) is a

central enzyme in a 10-step biosynthetic pathway expressed

in the medicinal plant Rauvolfia serpentina Benth ex Kurz

The pathway delivers the antiarrhythmic monoterpenoid

indole alkaloid ajmaline [1,2] From the enzymatic point of

view, this is presently one of the most detailed investigated

examples of a pathway leading to a natural product

Reactions of this complex biosynthetic sequence are

cata-lyzed by membrane-bound and soluble enzymes such as

cytochrome P450-dependent hydroxylases, a synthase,

sev-eral reductases, a methyltransferase and a set of hydrolases

including a b-glucosidase, an acetylesterase and the herein

described methylesterase PNAE [3] These enzymes exhibit a

high degree of substrate specificity, PNAE being the most

specific PNAE is located in the middle of the biosynthetic

chain starting from tryptamine and secologanin and

cata-lyses the conversion of polyneuridine aldehyde into the next

stable pathway intermediate, epivellosimine (Fig 1) The enzyme has been detected in and partially characterized from cell suspension cultures of R serpentina [4,5] PNAE has also been highly enriched from cultured plant cells and the cDNA was recently functionally expressed in Escherichia coli[6] Sequence alignment studies showed highest homol-ogies to an esterase involved in pathogen defence in rice [7] that hydrolyses naphthol esters, and to hydroxynitrile lyases (HNLs) from Hevea brasiliensis [8] and Manihot esculenta [9] The alignment suggested that PNAE is a new member of the a/b hydrolase superfamily that contains the putative catalytic triad serine, aspartic acid and histidine [10] For the present communication, a more detailed charac-terization of PNAE was performed by testing the influence

of various inhibitors, HNL substrates and by structure elucidation of a PNA derivative formed under in vitro conditions Mechanistic aspects of the reaction catalyzed were investigated by site-directed mutagenesis, replacing the amino acids of the putative catalytic triad and individual cysteine residues by alanine in order to characterize the mutant enzymes and to localize essential cysteines Model-ling experiments of PNAE based on the X-ray data of HNL from H brasiliensis [11,12] are described, allowing for the first time a deeper insight into a particular step of Rauvolfia alkaloid biosynthesis

M A T E R I A L S A N D M E T H O D S Materials

The expression vector pQE-70 was obtained from Qiagen (Hilden, Germany) Restriction enzymes SphI and BglII were from New England Biolabs (Beverly, USA) and T4-DNA ligase was from Promega (Madison, WI, USA)

Correspondence to J Sto¨ckigt, Institut fu¨r Pharmazie,

Johannes Gutenberg-Universita¨t Mainz, Staudinger Weg 5,

55099 Mainz, Germany.

Fax: + 49 61313923752, Tel.: + 49 61313925751,

E-mail: stoeckig@mail.uni-mainz.de

Abbreviations: AEBSF, 4-(2-aminoethyl)-benzenesulfonyl-fluoride

(trade mark name Pefabloc SC); DEPC, diethylpyrocarbonate; E-64,

N-[N-( L -3-trans-carboxirane-2-carbonyl)- L -leucyl]-agmatine; HNL,

hydroxynitrile lyase; PNAE, polyneuridine aldehyde esterase;

TPCK, L -chloro-3-(4-tosyl-amido)-4-phenyl-2-butanone; TLCK,

L -chloro-3-[4-tosyl-amido]-7-amino-2-heptanone; PNA,

polyneuridine aldehyde; PMSF, phenylmethanesulfonyl fluoride.

Enzyme: hydroxynitrile lyase (EC 4.2.1.39).

(Received 14 January 2002, revised 19 April 2002,

accepted 24 April 2002)

The QuikChangeTMin vitroSite-Directed Mutagenesis Kit

was obtained from Stratagene (La Jolla, CA, USA) For

purification of the His-tagged mutant enzymes, the

nitril-otriacetic acid/Ni2+resins were supplied by Qiagen (Hilden,

Germany) For the determination of molecular weight, a

Superdex 75 HR30/10 column (Amersham Pharmacia,

Freiburg, Germany) was used For the inhibition studies,

4-(2-aminoethyl)-benzenesulfonyl-fluoride (AEBSF; trade

name Pefabloc SC) and N-[N-(L

-3-trans-carboxirane-2-car-bonyl)-L-leucyl]-agmatine (E-64) were purchased from

Roche (Mannheim, Germany),L

-chloro-3-(4-tosyl-amido)-4-phenyl-2-butanone (TPCK) and L

-chloro-3-[4-tosyl-amido]-7-amino-2-heptanone (TLCK) were purchased

from Calbiochem (La Jolla, CA, USA),

phenylmethane-sulfonyl fluoride (PMSF) was from Serva (Heidelberg,

Germany), HgCl2from Merck (Darmstadt, Germany) and

diethylpyrocarbonate (DEPC) was from AppliChem

(Darmstadt, Germany) All solvents and chemicals were

of analytical grade and obtained from Merck (Darmstadt,

Germany), Sigma (Deisenhofen, Germany) or from

Appli-Chem (Darmstadt, Germany)

Site-directed mutagenesis

Site-directed mutagenesis of (His)6PNAE was achieved

using the QuikChangeTMin vitroSite-Directed Mutagenesis

Kit, according to the manufacturer’s recommendations For

generation of the mutant enzymes, the following

oligonu-cleotides were used: C20A: 5¢-CTGGTACACGGCGGAT

GTCTCGGAGCTTGGATCTGG-3¢ C132A: 5¢-CCGTT

TGAGAAGTACAATGAGAAGTGTCCGGCAGATA

TG-3¢ C170A: 5¢-GGCCCTCAAAATGTTCCAGAATT

GCTCAGTCGAGGACCTTG-3¢ C- 213S: 5¢-CGGTGA

AGCGAGCTTATATCTTTTGCAATGAAGATAAAT

CATTT-CC-3¢ C257A: 5¢GCCAAGGGAAGTTTGCA

5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG

GAGCTTGG-3¢ H- 86 A: 5¢-GGTTGTTCTTCTTGG

CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S87A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H244A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D216A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢

All of the primers were 5¢-phosphorylated and of high purity salt free grade The substituted nucleotides are underlined and written in bold script

Enzyme expression and purification For the expression of the mutated cDNAs, reading frames were amplified with the primer pair pQE70PErev and pQE70PEfor, which included the appropriate restriction sites (SphI and BglII) to enable the ligation into the expression vector pQE70 After ligation, the mutants were transformed into E coli strain TOP 10, and were grown at room temperature for 64 h without shaking, in Luria– Bertani medium containing 100 lgÆmL)1ampicillin From these cultures, crude extracts were prepared by sonification

at 4C with a Sonoplus Homogenisator HD 70 with sonotrode MS 73 and (Sonifier) HF-Generator GM 70 (70 W, 20 kHz) (Bachofer GmbH, Reutlingen, Germany) (6· 10 s) Activities of the mutated enzymes with substrate were monitored by a standard HPLC assay as recently described [6] The plasmids were purified by nucleospin mini preparation (Macherey–Nagel, Du¨ren, Germany), and sequenced by primer walking using the dideoxy chain termination method [13]

For protein purification, the mutated and the wild-type cDNAs were transformed into the E coli strain M15[pREP4] An inoculum of 50 mL was grown at 25C for 40 h in the above mentioned medium containing also kanamycin (25 lgÆmL)1), and was diluted 1 : 9 with the same medium After growing for 1 h with shaking (100 r.p.m), isopropyl thio-b-D-galactoside was added (1 mM final concentration) After further cultivation at

25C until a D600¼ 1.0–1.1 was reached, the cells were harvested by centrifugation (10 000 g, 4C) The pellet was re-suspended in 5 mL re-suspension buffer (50 mM NaH2PO4, 300 mM NaCl, pH 7.0) containing 10 mM imidazole and was sonicated at 4C (6 · 10 s) After centrifugation (10 000 g, 20 min) total PNAE activity was determined in the supernatant (His)6PNAE wild-type protein and the muteins were purified on self packed Ni2+ resin columns (0.7 cm internal diameter· 1 cm) For the washing steps, the above mentioned buffer containing 20 and 50 mMimidazole, each of 20 mL was used and elution was performed with 250 mM imidazole The purity of the eluted fractions was checked by SDS/PAGE The fractions with the highest protein concentration were combined and dialysed against 50 mM Na phosphate buffer, pH 7.0, containing 20 mM2-mercapoethanol for 20 h at 4C After determination of the enzyme activity with the standard enzyme assay, the kinetic studies (Km, kcat) were completed for the active muteins and for the wild-type enzyme

Enzyme and protein assays Protein concentrations of the muteins and the wild-type enzyme were determined with the Bradford reagent [14] using BSA (SERVA, Heidelberg, Germany) as standard

Fig 1 The major steps of the ajmaline pathway The biosynthesis of

the antiarrhythmic alkaloid ajmaline, in Rauvolfia serpentina cell

sus-pension cultures, involves the conversion of polyneuridine aldehyde

into epi-vellosimine This central reaction of the pathway is catalysed

by the enzyme polyneuridine aldehyde esterase (PNAE).

The enzyme activity in the pure fractions was assayed as

follows: the incubation mixture with a total volume of

50 lL contained a final concentration of 0.01 mM

poly-neuridine aldehyde (PNA) and 0.1M sodium phosphate

buffer (pH 7.0) with various enzyme concentrations The

mixture was incubated for 15 min at 30C After the

addition of 2 lL HCl (0.1M), 5 lL NaBH4solution (1% in

10 mM NaOH) and 0.1 mL MeOH, the mixture was

centrifuged (18 000 g, 5 min) and the supernatant was

analysed by the standard HPLC assay [6]

Assay for the production of the polyneuridine aldehyde

ethylester derivative

The incubation mixture with a total volume of 10 mL was

divided into 10· 1 mL aliquots For the most efficient

synthesis of the ethylester derivative, 0.1 mMof PNA was

incubated in 50 mMsodium phosphate buffer (pH 8.0) in

the presence of 15% EtOH, with various enzyme

concen-trations for 20 min at 30C The conversion was tested by

the standard HPLC method The reaction products were

extracted from the incubation mixture twice with 200 lL

CHCl3 and purified by preparative thin layer

chromato-graphy with the following solvent system; CHCl3/MeOH/

25% NH3 (9 : 1 : 0.02) The products were identified by

EI-mass spectrometry on a Finnigan MAT 44S quadrupole

instrument (Bremen, Germany) by direct inlet and 70 eV

Molecular mass determination

For the determination of the relative molecular mass,

100 lL of (His)6PNAE wild-type protein, obtained from

E coli M15 cells (0.68 mgÆmL)1) was loaded onto a

superdex column and fractionated (each 0.5 mL) with a

50 mM Na phosphate buffer pH 7.0 containing NaCl

(150 mM) For comparison, the same procedure was

repeated with 100 lL of the crude extract preparation of

the enzyme (2.0 mgÆmL)1) from Rauvolfia plant cell

suspension culture

Inhibition studies

The effects of the following inhibitors, in the mentioned

concentrations, were checked on the pure (His)6PNAE

enzyme fractions that were dialysed against 50 mMsodium

phosphate buffer before use (pH 7.0, for 20 h at 4C):

AEBSF (1.0 mM, 4.0 mM), phenylmethanesulfonyl fluoride

(1.0 mM), TPCK (200 lM), TLCK (120 lM), E-64 (25 lM),

HgCl2 (200 lM), DEPC (0.8–1.2 mM) The enzyme

frac-tions, except DEPC, were preincubated with inhibitor for

1 h at 30C With DEPC, the enzyme was preincubated at

4C for 30 min Then the activity of the enzyme was tested

Model-building

A model of the three-dimensional structure of (His)6PNAE

was constructed using a homology-modelling approach

based on the precalculated alignment of the hydroxynitrile

lyase to which PNAE has 43% identity The X-ray structure

of hydroxynitrile lyase from H brasiliensis was used as a

template structure [11] (Protein Data Bank accession no

1YAS) The model structures were calculated using the

software (version 4) [15], a program that models

structures by satisfaction of spatial restraints Fifteen models were created for wild-type PNAE The CCP4 program suite [16] was used for the superposition of the models and calculations

R E S U L T S Sequence analysis of recently expressed (His)6PNAE in

E coliplaced this specific enzyme of ajmaline biosynthesis,

as a new member, into the a/b hydrolase enzyme super-family Most typical for this class of hydrolases are the three strictly conserved amino acids Ser, Asp, and His, which could represent the catalytic triad of PNAE [6] Moreover, re-activation of an enzyme preparation by 2-mercapoetha-nol suggested free SH-groups to be necessary for hydrolytic activity of PNAE In order to gain evidence for these suggestions, inhibitor studies, site-directed mutagenesis experiments and modelling of PNAE were performed

Inhibitor studies Several known inhibitors reacting with the amino acids Ser, Cys or His were tested on wild-type (His)6PNAE (Table 1) Pefabloc SC (AEBSF), a selective serine modifying agent [17], did not influence the enzyme activity at a variety of concentrations, which was also observed for the Cys selective inhibitor E-64 [18] Partial inhibition of 20 and 12% of PNAE was measured with the Ser-Cys inhibitors phenylmethanesulfonyl fluoride and TLCK, respectively TPCK had, however, no effect on catalytic activity Incubation of purified (His)6PNAE wild-type enzyme in the presence of Hg+2resulted in complete loss of catalytic activity, which was recovered (90%) after adding 60 mM 2-mercapoethanol Complete inhibition occurred with DEPC, which is a strong histidine-modifying agent [19]

Extraordinarily high concentrations of 2-mercapoethanol (up to 2M) did not reduce the activity of (His)6PNAE

Site-directed mutagenesis

In this study, we have produced wild-type (His)6PNAE and

10 muteins of it Four of six cysteine residues in positions 20,

132, 170 and 257 were changed to alanine and one (position 213) to serine Histidine at position 17, 86 and 244, serine at

87 and aspartic acid at 216 were replaced by alanine Among these, Ser87, Asp216 and His244 formed the putative catalytic triad of PNAE, analogous to

H brasiliensisHNL and most other a/b hydrolase enzyme superfamily members [10]

Table 1 Inhibition studies with pure (His) 6 PNAE The experiments were performed with SH-group modifiers, selective serine-, cysteine-and histidine-inhibitors cysteine-and serine-cysteine modifying agents Inhibitor (m M ) Modified residue Inhibition (%)

TLCK (0.12) Serine-Cysteine 12

Expression of (His)6PNAE muteins in E coli

These muteins were expressed in E coli M15 using the

bacterial expression vector pQE-70 Purification of the

wild-type enzyme and the individual muteins was facilitated by

introduction of a His-tag at the N-terminus followed by

step-gradient elution with imidazole from Ni2+

-nitrilotri-acetic acid columns Except for the inactive muteins, all the

active enzyme preparations showed a purity of > 95%,

based on SDS/PAGE and Coomassie-blue staining (Fig 2)

The degree of enzyme purity among the active muteins and

the wild-type preparations was comparable

Enzyme activity and kinetics

The enzyme activity tests using PNA as substrate were

performed with the wild-type enzyme and its individual

muteins after purification The site-directed mutagenesis results verified that the strictly conserved amino acids identified by multiple sequence alignment [6], namely Ser87, Asp216 and His244, formed the catalytic triad of (His)6 PNAE After they were individually replaced by alanine, the activity of the enzyme was lost completely (Table 2) With the Cys muteins, the results were variable After mutating Cys213 and 257, the specific activity of the enzyme was not considerably affected, even though the mutant enzyme C213S contained a second mutation that occurred fortuit-ously during PCR The glycine at position 152 was exchanged for glutamic acid, which seemed not to have further influence on activity Nevertheless, the specific activities of each of the muteins decreased With the exchange of Cys132, there was a dramatic decrease (four-fold) in the specific activity, and in the case of Cys170, the decrease in the specific activity was even greater (approx sevenfold) The exchange of Cys20 resulted in the total inactivation of the mutant enzyme For the remaining two histidines, the results were also remarkable When His17 was changed to Ala, the specific activity significantly decreased, but still the kinetic data could be determined But in the case of His86, the activity was so low that it was not possible to perform further kinetic experiments The specific activity could, however, be measured (Table 2) The kinetic parameters, such as Km, and kcat, for the wild-type and the muteins are given in Table 2, together with the specific enzyme activities ranging from 32 to 24 pkatÆmg)1 for active preparations The Km value of the wild-type enzyme is smaller than previously reported [6] For muteins with low activity, up to  300-fold higher amounts of enzyme and prolongation of incubation periods from

10 min to 3 h were used, which were sufficient to determine relative activities equivalent to 0.1% compared to the wild-type PNAE

Substrate specificity experiments with racemic mandelonitrile

The activity of wild-type (His)6PNAE was tested on racemic mandelonitrile, which is the natural substrate for the FAD dependent HNL from Prunus sp (Rosaceae) [9] but accepted as well by H brasiliensis HNL The specific activity was measured by following the formation of

Fig 2 Gradient-step purification of (His) 6 PNAE and its muteins The

soluble protein extracts were in each case purified by step gradient

elution with imidazole on Ni 2+ -nitrilotriacetic acid columns The

fractions were checked by SDS/PAGE and Coomassie-blue staining.

The position of the purified proteins is marked with an arrow The

labelling of the lanes is as follows: (A) Marker protein, (B) crude E coli

extract, (C) pure wild-type (His) 6 PNAE, (D) H17A, (E) C20A,

(F) H86A, (G) C132A, (H) C170A, (I) C213S, (J) C257A, (K) S87A,

(L) H244A, (M) D216A.

Table 2 Comparison of kinetic parameters of (His) 6 PNAE and its muteins expressed in E coli K m and k cat values were calculated from Lineweaver– Burk plots using PNA as substrate Values of linear regression coefficients were >0.9 in all experiments ND, not detectable.

Enzyme

K m

(l M )

Specific activity (nkatÆmg protein)1)

k cat

(nkatÆmg protein)1)

Protein conc in incubation (lgÆmL)1)

benzaldehyde (detection limit 0.5%) as described in the

mandelonitrile assay for HbHNL [20] But as expected, the

highly substrate-specific PNAE did not accept the substrate

of H brasiliensis HNL, as in the case of earlier substrate

specificity experiments with various methylesters [6]

Identification of a new intermediate of the PNAE

reaction and first recognition of a novel substrate

When the enzyme assay was performed in the presence of

ethanol, a novel intermediate was detected by HPLC

analysis showing a retention time of 7.3 min This

com-pound, which is the ethyl ester derivative of PNA, is

accepted by the enzyme as shown by its conversion into

vellosimine after prolonged incubation or when excessive

amount of PNAE is added (data not shown) This is the

only known compound that is accepted by the enzyme in

addition to its natural substrate PNA After optimization of

assay conditions for its formation, the product was isolated

and analysed by MS EI-MS data were m/z (%): 366 (37,

M+), 365 (37, M+-1), 335 (17, M+-CH2OH), 249 [71,

365-C(CH2OH)CO2CH2CH3], 235 (15), 182 (24), 168 (100),

156 (21), 143(12), 129 (15), 115 (21)

Molecular mass determination

PNAE was found to migrate on SDS/PAGE with a

mobility corresponding to an apparent molecular mass of

30 000 Da [6] After gel filtration of the recombinant and

the native enzyme through a Superdex column, a relative

molecular mass of 60 000 Da was determined, suggesting

that the enzyme is a homodimer in aqueous solutions at

pH 7.0 The dimer had not been observed earlier with an

enriched PNAE preparation chromatographed on an AcA

54 column [4,5]

Modelling

Based on the three-dimensional structure of HNL from

H brasiliensis, which is known from an X-ray analysis with

2.3 A˚ resolution [11], a model of (His)6PNAE was con-structed For this purpose, 15 different models were generated by the modeller program The deviations between these models were generally small for the backbone atoms (rmsd from 0.2 to 0.6 A˚) The model with the best stereochemistry was selected for the wild-type structure All the measurements given in the text represent the Ca–Ca distances

D I S C U S S I O N Indole alkaloid biosynthesis of the ajmaline/sarpagine group which occurs in the genus Rauvolfia, has been well-elucidated during the last decade For a more detailed determination of enzyme properties and structures and for knowledge of the catalytic mechanisms, heterologous expression of the appropriate cDNAs is a prerequisite Sequence alignments of PNAE with the other enzymes of the a/b hydrolase family showed identity up to 43% with HNL from H brasiliensis This can be considered as high in this particular enzyme family, suggesting that the two enzymes are closely related to each other [10,21] Gel filtration showed that at neutral pH, PNAE forms a homodimer, as do HbHNL and acetylcholine esterase [22] Due to recovery of enzyme activity with 2-mercapoethanol after HgCl2 inhibition, a probable formation of an S–S bridge resulting in homo-dimerization was taken into consideration However, high amounts of 2-mercapoetha-nol, which would lead to the dissociation of such a dimer into both subunits [23], did not affect the activity of PNAE The dimerization obviously does not depend on cysteine residues, but most probably takes place via a contact area of apolar residues [12], as the sequence comparison between the HbHNL and PNAE gives a pronounced homology of 75% (Fig 3) at these apolar sections Also, as the dimeric nature was observed both for the native enzyme and the recombinant (His)6-PNAE, the His-tag has no apparent influence on dimer formation

In contrast, from the point of view of substrate accept-ance, there are no similarities between the enzymes Whereas

Fig 3 Sequence alignment of PNAE and H brasiliensis HNL The gray shading indicates the sequence identity (43%) between the two enzymes The yellow regions are the apolar sections which may be responsible for the dimerisation of PNAE For HbHNL these regions are dark gray with white letters There is a sequence similarity of 82% between the two apolar sections The residues marked red with a star above form the catalytic triad The mutations which reduce the activity are shown in blue and the mutations leading to complete loss of enzyme activity are marked in green.

HNLs have a rather broad substrate specificity, PNAE will

only accept its natural substrate and the ethyl analogue

When the assays of PNAE were performed in presence of

ethanol in order to dissolve PNA, a second conversion

product was observed by HPLC The addition of more

enzyme to these incubations resulted in conversion of this

compound to vellosimine The structure determination of

this intermediate by mass spectrometry proved the

forma-tion of an ethyl ester, a PNA analogue, which is the only

other substrate so far known to be accepted by the enzyme

The formation of this analogue, which is most probably

formed by trans-esterification of the substrate, was

previ-ously detected also for the enriched enzyme fractions from

the plant cells It can be speculated that an enzyme-bound,

activated intermediate of the substrate, such as PNA acid

bound as a thioester to a cysteine SH-group, might be

involved in the mechanism However, replacement of

several cysteine residues of PNAE (see data below) by

alanine did not influence the formation of the analogue

The mechanism of this process therefore remains to be

elucidated

The results of the inhibition studies were also helpful to

define potential active residues The complete inhibition of

the enzyme with HgCl2showed the importance of cysteine

residues for the activity However, at this stage it still

remained unclear whether PNAE is a cysteine or serine hydrolase, regarding studies with cysteine and serine protease inhibitors The next clear information obtained was the necessity of histidine groups which proved the active role of at least one histidine in substrate binding The following site-directed mutation experiments were therefore designed to prove whether PNAE is indeed a member of the a/b hydrolase fold enzyme family, as we have suggested recently [6] If so, PNAE must harbour the catalytic triad nucleophile-histidine-acid Based on sequence alignment, Ser87 is a member of the consensus sequence Gly-X-Ser-X-Gly/Ala in PNAE, which defines this residue in serine hydrolases It is most probable that PNAE can be classified among this group Replacement of Ser87 by alanine formed

a mutein that was unable to hydrolyse PNA even when 330-fold excess of enzyme was used compared to the wild-type This result indicates an absolute involvement of Ser87 in the catalytic process Exchange of His244 gave a mutein that was completely inactive in the PNA hydrolysing assay, even

if a 200-fold excess of enzyme was used This shows unequivocally that His244 belongs to the catalytic triad Exchange of the last putative member of the catalytic triad, which from alignment studies is aspartic acid at position

216, also gave a mutein devoid of any PNA-hydrolytic activity Even a 50-fold excess of this mutein gave no

Fig 4 Stereo pictures of the modelled structure of (His) 6 PNAE Only the backbone and the side-chains of the mutated amino acids are shown The amino acids of the catalytic triad, mutations which reduced the activity of (His) 6 PNAE and mutations with a complete loss of activity are drawn in red, blue and green, respectively The direction of view is along the channel connecting the active site with the outside of the protein (B) shows the view of (A) when rotated along the y axis by 90.The pictures were generated using the programs [24] and 3 [25].

measurable conversion of PNA The position of this

particular aspartic acid in the sequence and in the model,

is consistent with the complete inactivation of the mutant

enzyme This suggests that Asp216 does indeed represent

the acidic residue in the active centre of PNAE All these

kinetic results and theoretical data given by sequence

alignments support the assumption illustrated by the model

(Fig 4) that in PNAE, the typical catalytic triad of the a/b

hydrolase family is conserved The model also suggests that

the active site is deeply buried inside the protein and is

connected to the protein surface by a narrow channel (not

illustrated) The mutation of two residues Cys20 and

Cys132, which are located at the entrance of this narrow

channel, gave interesting results The complete loss of

activity in the case of Cys20, which has a deeper location

than Cys132, suggests its extraordinary function for

cata-lysis This may be related to its direct contribution via a free

SH-group directed into the channel Cys132 seems to also

play an important role When it was exchanged, a loss of

75% in specific activity was observed but more interestingly

the Kmvalue increased to threefold of that of the wild-type

enzyme This might indicate that the intake of the substrate

is hampered supporting the location of Cys132 discussed

above

To identify histidine residues in PNAE responsible for

catalysis, His17 and His86 were replaced by alanine In the

case of His17, which is a very conserved residue in a/b

hydrolases, there was a 162-fold decrease in the specific

activity even though the imidazole ring seems to point

outward, in the opposite direction of the active centre

(Fig 4) The eightfold increase in the Kmvalue (Table 2)

compared to wild-type may demonstrate a strong influence

of this residue on maintaining the conformation in addition

to its probable contribution to the hydrolysis mechanism

His86, which is a direct neighbour of the catalytic Ser87

(3.8 A˚), with an imidazole ring directed towards the active

centre, showed a 1600-fold decrease in specific activity This

suggests a strong change at least in the steric properties of

the substrate binding site However, it remains unclear as to

how these histidines finally influence PNA hydrolysis

Another amino acid interesting for PNAE activity is

cysteine Therefore, additional cysteine mutation studies

were carried at positions 213, 257 and 170 C213S and

C257A showed almost 33% loss in their specific activities;

for C170A this decreased to 85% The models (Fig 4) show

how closely Cys213 is located to Asp216 (5.8 A˚), whereas

Cys257 is located further away (17.9 A˚) Interestingly, the

inhibition of the enzyme in both cases is almost identical

Cys170 is also located behind the catalytic triad member

His244 at a distance of 9.3 A˚, but nevertheless exhibiting a

great loss in the specific activity The influence of these

residues on the activity by modelling at this stage is not

clear On the other hand, the Kmvalues for the three muteins

are almost identical to that of the wild-type, indicating that

these cysteines might not have a big influence on the binding

of the substrate

In conclusion, we have identified by site-directed

muta-genesis the residues of the catalytic triad Ser87, Asp216 and

His244 of PNAE The order of these catalytic amino acids

corresponds to that of the a/b hydrolase family, which

suggests that PNAE is indeed a novel member of this group

The locations of the mutated residues in the model and the

kinetic results support the notion that the enzyme has a very

similar topology to HbHNL However, to gain more insight into the mechanism of hydrolysis and the conformation of PNAE, it would be necessary to perform X-ray diffraction analysis

A C K N O W L E D G E M E N T S

This work was supported by a grant of Deutsche Forschungsgeme-inschaft (Bonn, Bad-Godesberg, Germany), the Fonds der Chemischen Industrie (Frankfurt/Main, Germany) and by BMBF (Bonn, Germany) Dr Xueyan Ma acknowledges BASF (Ludwigshafen, Germany) for a scholarship.

R E F E R E N C E S

1 Sto¨ckigt, J (1995) Biosynthesis in Rauvolfia serpentina, modern aspects of an old medicinal plant In The Alkaloids (Cordell, G.A., ed.), Vol 47, pp 115–172 Academic Press, San Diego, CA, USA.

2 Kleinsorge, H (1959) Klinische Untersuchungen u¨ber die Wirkungsweise des Rauwolfia Alkaloids (Ajmalin) bei Herzrhy-thmussto¨rungen insbesondere der Extrasystole Med Klin.

54, 409–416.

3 Sto¨ckigt, J (1998) Alkaloid metabolism in plant cell culture In Natural Product Analysis (Schreier, P., Herderich, M & Humpf, H.-M., eds), pp 313–325 Vieweg, Braunschweig, Wiesbaden, Germany.

4 Pfitzner, A & Sto¨ckigt, J (1983) Polyneuridine aldehyde esterase:

an unusually specific enzyme involved in the biosynthesis of sar-pagine type alkaloids J Chem Soc Chem Commun 459–460.

5 Pfitzner, A & Sto¨ckigt, J (1983) Characterization of poly-neuridine aldehyde esterase, a key enzyme in the biosynthesis of sarpagine/ajmaline type alkaloids Planta Med 48, 221–227.

6 Dogru, E., Warzecha, H., Seibel, F., Haebel, S., Lottspeich, F & Sto¨ckigt, J (2000) The gene encoding polyneuridine aldehyde esterase of monoterpenoid indole alkaloid biosynthesis in plants is

an ortholog of the a/b hydrolase super family Eur J Biochem.

267, 1397–1406.

7 Wa¨spi, U., Misteli, B., Hasslacher, M., Jandrositz, A., Kohlwein, S.D., Schwab, H & Dudler, R (1998) The defense-related rice gene Pir7b encodes an a/b hydrolase fold protein exhibiting esterase activity towards naphthol AS-esters Eur J Biochem 254, 32–37.

8 Hasslacher, M., Schall, M., Hayn, M., Griengl, H., Kohlwein, S.D & Schwab, H (1996) Molecular cloning of the full-length cDNA of (S)-hydroxynitrile lyase from Hevea brasiliensis J Biol Chem 271, 5884–5891.

9 Hughes, J., de Carvalho, F.J.P.C & Hughes, M.A (1994) Puri-fication, characterization, and cloning of a-hydroxynitrile lyase from cassava (Manihot esculenta Crantz) Arch Biochem Biophys.

311, 496–502.

10 Ollis, D.L., Cheah, E., Cygler, M., Dijkstra, B., Frolow, F., Franken, S.M., Harel, M., Remington, S.J., Silman, I., Schrag, J., Sussman, J.L., Verschueren, K.H.G & Goldman, A (1992) The a/b hydrolase fold Protein Eng 5, 197–211.

11 Gruber, K., Gugganig, M., Wagner, U.G & Kratky, C (1999) Atomic resolution crystal structure of hydroxynitrile lyase from Hevea brasiliensis Biol Chem 380, 993–1000.

12 Wagner, U.G., Hasslacher, M., Griengl, H., Schwab, H & Kratky,

C (1996) Mechanism of cyanogenesis: the crystal structure of hydroxynitrile lyase from Hevea brasiliensis Structure 4, 811–822.

13 Sanger, F., Nicklen, S & Coulson, A.R (1977) DNA Sequencing with chain-terminating inhibitors Proc Natl Acad Sci USA 74, 5463–5467.

14 Bradford, M (1976) A rapid and sensitive method for the quan-titation of microgram quantities of protein utilizing the principle

of protein-dye binding Anal Biochem 72, 248–254.

15 Sali, A & Blundell, T (1993) Comparative protein modelling by satisfaction of spatial restraints J Mol Biol 234, 779–815.

16 Collaborative Computational Project Number, 4 (1994) The

CCP4 suite: programs for protein crystallography Acta Cryst.

D50, 760–763.

17 Mintz, G.R (1993) Technical note: an irreversible serine protease

inhibitor Biopharm 6, 34–38.

18 Umezawa, H & Aoyagi, T (1983) In Protease Inhibitors: Medical

and Biological Aspects (Katunuma, N., ed.), pp 3–15 Springer

Verlag, Berlin.

19 Miles, E.W (1977) Modification of histidyl residues in proteins by

diethylpyro-carbonate Methods Enzymol 47, 431–442.

20 Hanefeld, U., Straathof, A.J.J & Heijnen, J.J (1999) Study of the

(S)-hydroxynitrile lyase from Hevea brasiliensis: mechanistic

implications Biochim Biophy Acta 1432, 185–193.

21 Heikinheimo, P., Goldman, A., Jeffries, C & Ollis, D.L (1999) Of barn owls and bankers: a lush variety of a/b hydrolases Structure

7, R141–R146.

22 Sussman, J.L & Silman, I (1991) Atomic structure of cholinesterase from Torpedo californica: a prototypic acetyl-choline-binding protein Science 253, 872–879.

23 Esen, A (1992) Purification and partial characterisation of maize (Zea mays L.) b-glucosidase Plant Physiol 98, 174–182.

24 Esnouf, R.M (1999) Further additions to Molscript version 1.4 including reading and contouring of electron-density maps Acta Cryst D55, 938–940.

25 Merritt, E.A & Bacon, D.J (1997) Raster3D – photorealistic molecular graphics Methods Enzymol 277, 505–524.