... Desilva, A. M. Y.J., Sotheeswaran, S., Balasubramaniam, S., Wazeer, M. I .M. , 1984 Terpenoids and biflavonoids constituents of Calophyllum calaba and Garcina spicata from Sri Lanka Phytochemistry 23, 32 3 32 8 ... Nkengfack The authors also thank Mrs C Caux and Mr A Blond for the NMR spectra measurements, Mr J.P Brouard and L Dubost for mass spectral analyses, and Mr G Gastine for antimicrobial assay References ... (KB) and for their antimicrobial and potency against representative Gram-(+), Staphylococcus aureus (ATCC6 538 ), Vibrio anguillarium (ATCC19264), Gram-(À), Escherichia coli (ATCC8 739 ) bacteria, and...
Ngày tải lên: 07/06/2016, 23:44
... Because drying a sample changes metal speciation, the metals in the moist sample were extracted immediately acid digestion (HNO~-HC104) to estimate leachable, plant available, and total metal content, ... measured by 0.01 M CaC12 extraction and plant available metal as measured by 0.1 M DTPA extraction are related to the metal in exchangeable and in exchangeable/carbonates fractions, respectively, ... of metal speciation and leachable metal Since a M MgC12 solution is a stronger extractant than a 0.01 M CaC12 solution for metals from cation sites, more metals can be extracted by the former,...
Ngày tải lên: 23/09/2012, 14:47
Tài liệu Module 3: Designing a Software Distribution and Management Strategy ppt
... distributed organization Which technologies can you use to install packages from a command line, and what format can the packages use? Both SMS and Windows Installer can install packages from a command ... Distribution and Management Strategy Comparing SMS and IntelliMirror Software Deployment Topic Objective To compare the distribution and management features of SMS and IntelliMirror Packaging—Both Can ... Distribution and Management Strategy 15 Systems Management Server Topic Objective To introduce the features and capabilities of SMS as an appropriate option for software distribution and management Packaging—Windows...
Ngày tải lên: 10/12/2013, 15:15
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS 030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... breast carcinoma cells Oncogene 20, 2499–25 13 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated ... comprised: RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2 )3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG ... previously assumed [33 ] There is an intriguing similarity between STAT3 and STAT1 Both factors share activating stimuli and a high homology of sequence, and they have common gene targets and recognize...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu A General History and Collection of Voyages and Travels, Vol.3 ppt
... Algarve, Algezira, Gibraltar, and the Canary islands, Lord and Lady of Biscay and Molina, Duke and Duchess of Athens and Neopatria, Count and Countess of Boussillon and Cerdagne, Marquis and Marchioness ... motion, or by way of appeal or complaint, and may examine, determine, and decide them as our viceroy and governor: and you and your children may all that is reasonable in such cases, and in all ... and Leon actually enjoy; and that all the perquisites and salaries, appertaining and belonging to the said offices, and granted and allowed to our admirals, viceroys, and governors, may be made...
Ngày tải lên: 21/02/2014, 11:20
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
... had taken off her mask It was a disastrous situation for me, and one all too difficult to carry off with dignity “Madame,” I said “I am the Marqués de Casa Triana I met Lady Monica some time ago, ... my brown face and black eyes, many a Cornishman has a face as brown and eyes as black; therefore, I edited the name of Triana into Cornish Trevenna, and changed Cristóbal, my middle name, into ... to Barcelona, from Marseilles.” This was a sore subject It is not my fault that my father was as recklessly brave a general, and as obstinately determined a partisan as Don Carlos ever had If...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo Y học: Variations in receptor site-3 on rat brain and insect sodium channels highlighted by binding of a funnel-web spider d-atracotoxin pdf
... within months Membrane protein concentration was determined by a BioRad Protein Assay Kit, using BSA as a standard Purification of d-ACTX-Hv 1a and d-ACTX-Ar1 Radioiodination of d-ACTX-Hv1, LqhaIT and ... performed at 22 °C to maintain the resting membrane potential for longer duration (Fig 1A [42]) Maximal binding was achieved after 10–15 and was maintained for an additional 10 before an apparent ... 1Æml min)1 Toxin quantification was performed using a bicinchoninic acid Protein Assay Kit (Pierce) using BSA as a standard Absorbance was read at 570 nm on a BIO-RAD Model 450 microplate reader...
Ngày tải lên: 08/03/2014, 16:20
Chương 6 QU N TR CHI N LƯ CChi n lư c c p công tyTi n sĩ Nguy n Văn S.nM c tiêu nghiên c u1. Làm rõ t m quan tr ng c a chi n lư c c p công ty. 2. Tìm hi u n i dung cơ b n mà chi n lư c c p công ty ph i ñ t ra và gi i quy t. 3. N m ñư c các lo i hình potx
... Strategy) Strategy) Các chi n lư c a d ng h a ho t ñ ng: Chi n lư c a d ng h a ñ ng t m Chi n lư c a d ng h a hàng ngang Chi n lư c a d ng h a k t h p 6-21 Chi n lư c a d ng h a ñ ng t m M ... C ng c b ng cách gi m b t qui m : V n gi nguyên s lư ng SBU tham gia ngành khác c a doanh nghi p Nhưng t m th i c t b t chi phí, gi m qui m ho t ñ ng c a SBU hay t m ngưng m t s ho t ñ ng ñ c ... t h p gi i pháp liên doanh, mua l i, sáp nh p… 6-22 11 Chi n lư c a d ng h a hàng ngang M c tiêu: tăng doanh l i qua phát hành s n ph m m i (không liên quan ñ n s n ph m hi n h u) th trư ng hi...
Ngày tải lên: 15/03/2014, 17:20
Chương 8 QU N TR CHI N LƯ CChi n lư c c p ch c năngTi n sĩ Nguy n Văn S.nM c tiêu nghiên c u1. Làm rõ t m quan tr ng c a chi n lư c c p ch c năng. 2. Tìm hi u n i dung cơ b n mà chi n lư c c p ch c năng ph i ñ t ra và gi i quy t. 3. N m ñư c các lo pptx
... v sinh, an toàn th c ph m K t h p ñ m b o trách nhi m xã h i c a s n ph m x lý m i trư ng 8- 13 Qu n tr ch t lư ng Bi n pháp: qu n tr ch t lư ng t ng h p (Total Quality Management – TQM ) ISO ... khách hàng m t cách nhanh chóng nh t ñi u ki n có th 8-15 Qu n tr marketing M c tiêu: ðáp ng t t nh t nhu c u (mong mu n m c c u) c a khách hàng m c tiêu Nâng cao s c c nh tranh, m r ng th ph ... ph a sau Just-in-time (JIT) h m ch a r i ro l n trình cung ng có th b gián ño n m l c lư ng t n kho d phòng 8-9 Qu n tr s n xu t M c tiêu: S n xu t hàng h a, d ch v ñáp ng ñ y ñ yêu c u c a c a...
Ngày tải lên: 15/03/2014, 17:20
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... 3. 38 3. 39 (E) 4.09 3. 97 3. 96 3. 81 4.18 4.17 4.09 (F) 4.66 3. 32 3. 50 3. 40 3. 43 4.08 3. 96 3. 93 3. 83 Polymer III 3. 90 3. 72 * or 2); CH3CON, d1. 93 and 2.07 chromatography [25] The absolute configuration ... of an immobilized aldolase in the first synthesis of a natural deaminated neuraminic acid J Chem Soc., Chem Commun 859–860 29 Naumova, I.B., Shashkov, A. S., Tul’skaya, E .M. , Streshinskaya, G .M. , ... fi4)-b-D-ManpNAc3NAcA-(1fi (B) 4.90 H -3 H-3ax H-3eq H-4 H-5 3. 36 3. 58 4.40 4 .33 3. 40 3. 69 3. 93 4. 03 3.98 3. 88 3. 95 3. 55 4.01 3. 80 3. 66 H-5¢ H-6 H-6¢ H-7 H-8 H-9 H-9¢ Polymer II (C) 1.78 2.20 (D) 4.55 3. 31 3. 50 3. 38...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... GalNAc:H1 GalNAc:H3 GalNAc:H3 Gal:H1 Gal:H1 Gal:H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 3. 77 3. 77 4.82 4.82 3. 53 1.79 1.79 1.79 GalNAc:H2 GalNAc:H2 Gal:H1 Gal:H2 Gal:H3 Gal:H4 Gal:H2 Gal:H3 ... a- cyano-4-hydroxycinnamic acid and irradiated with 282 nm irradiation from a nitrogen laser using a DE-Star (Perceptive, Framingham, MA, USA) mass spectrometer The mass accuracy of the MALDI instrument for ... Gal:H4 3. 95 3. 95 4.82 3. 53 3. 43 3.72 3. 53 3. 43 3.72 Proton (1H) Chemical shift (p.p .m. ) Proton (1H) Chemical shift (p.p .m. ) GalNAc:H1 GalNAc:CH3 GalNAc:H3 GalNAc:H1 Gal:H2 Gal:H2 4.79 1.79 3. 77...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx
... equilibrated with 100 mM ammonium acetate, pH The mate- rial was eluted with the same buffer at a flow rate of 0.2 mLÆmin)1 Absorbance of the eluate was monitored at 280 nm and 4-mL fractions ... vector-related fragments In a parallel experiment with AgTx2, chromatographic profiles of rAgTx2 and commercially available rAgTx2 (Alomone Laboratories) under the same conditions were compared and ... C-terminal arginine, was designed as follows (Fig 3A) Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG -3 , 3 -CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG...
Ngày tải lên: 31/03/2014, 09:20
conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.
... Cosmological Crossroads An Advanced Course in Mathematical, Physical and String Cosmology Vol.5 93: D Shi, B Aktas, L Pust, F Mikhailov (Eds.), ¸ Nanostructured Magnetic Materials and Their Applications ... Mathematical Sciences Komaba 3- 8-1, 1 53 Tokyo, Japan Franco Magri Universit` degli Studi Bicocca a Dipartimento di Matematica Via Bicocca degli Arcimbold 20126 Milano, Italy Pavel Winternitz C.R.D.E., ... (Eds.), The Mathematical Aspects of Quantum Maps Vol.619: H .M Antia, A Bhatnagar, P Ulmschneider (Eds.), Lectures on Solar Physics Vol.620: C Fiolhais, F Nogueira, M Marques (Eds.), A Primer in Density...
Ngày tải lên: 24/04/2014, 16:50
adobe photoshop elements 3 0 a z tools and features illustrated ready reference may 2005
... saved in the GIF format In the process, each layer is made into a separate frame in an animated sequence As the GIF is a format used for small animations on the Net, the moving masterpiece can ... keywords are attached to it The database that Elements creates is called a catalog and is used by the program to track and help organize your files A new catalog is automatically created when ... a simple border creation technique that also uses the Stroke feature See below OS: Mac, Windows See also: Gradients All command A Photoshop Elements 3. 0 A- Z Frame Frame Animation preview Animated...
Ngày tải lên: 04/06/2014, 11:27