2 1 the dormant basket cell hypothesis
Patterns of hippocampal neuronal loss and axon reorganisation of the dentate gyrus in the mouse pilocarpine model of temporal lobe epilepsy
... model………………………………………………………… .22 1. 4 .2 Hypotheses of epileptogenesis from previous studies………………… 22 1. 4 .2. 1 The dormant basket cell hypothesis ………………………… .22 1. 4 .2. 2 Loss of interneurons and its ... (GC)…………………………………………… 1. 1 .1 .2 The mossy cells…………………………………………………….6 1. 1 .1. 3 The pyramidal basket cells…………………………………………7 1. 1 .1. 4 Other interneurons of the dentate gyrus……………………………8 1. 1 .2 Associational/commissural ... 19 1. 4 Hypotheses of epileptogenesis for temporal lobe epilepsy (TLE)…………… 21 1. 4 .1 Animal models of temporal lobe epilepsy……………………………… 21 1. 4 .1. 1 Kindling model………………………………………………… 21 1. 4 .1. 2...
Ngày tải lên: 11/09/2015, 16:04
Báo cáo hóa học: " Lateral homogeneity of the electronic properties in pristine and ion-irradiated graphene probed by scanning capacitance spectroscopy" pot
... Research Letters 20 11 , 6 :10 9 http://www.nanoscalereslett.com/content/6 /1/ 109 0 .10 graphene 0.05 0.00 Aeff (x10 nm ) n e Ctot (a.u.) -0.05 0.05 10 SiO2 SiO2 m (a) graphene -1 10 -2 10 (b) 1. 0 Atip Page ... Unirradiated (b) =1x10 cm 13 -2 Charged impurities vacancies i 50 14 (c) -2 =1x10 cm vacancies Charged Ch d impurities 0 10 20 40 50 60 10 -2 NCI, Nvac (10 cm ) Figure Histograms of the locally measured ... 〈Nci〉 = 50 × 10 10 cm -2 and with FWHM of × 10 10 cm -2 l (nm) Giannazzo et al Nanoscale Research Letters 20 11 , 6 :10 9 http://www.nanoscalereslett.com/content/6 /1/ 109 40 CI Unirradiated 20 40 l (nm...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"
... Placebo 19 47.7 6.5 38.3 9.0 34.0, 42. 7 0.0 013 5-Loxin 10 0 mg/day 19 48 .2 6 .1 26 .2 16 .5 18 .2, 34 .1
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... objectively in a complementary manner, via studies of the MMN [10 3] 1 52 10 11 12 13 14 15 16 17 18 Closing Remarks Each of the specific components of the Event-Related Potential discussed in this review ... humans Neuroreport 19 99; 10 :8 61- 865 79 Bekker EM, Kenemans JL, Verbaten MN Source analysis of the N2 in a cued Go/NoGo task Brain Research Cognitive Brain Research 20 05; 22 (2) :22 1 -23 1 80 Barabasz ... University Press 19 90 :14 5 -15 7 Näätänen R, Picton TW N2 and automatic versus controlled processes Electroencephalography and Clinical Neurophysiology 19 86; 38 :16 9 -18 6 25 26 27 28 29 Näätänen R The role...
Ngày tải lên: 02/11/2012, 11:08
Teachers’ and teacher evaluators’ perceptions of the current teacher evaluations and teaching assessment criteria
... points; criteria 1, 4,6,9 must get points Fair: From 13 -16 ,5 points; criteria 1, 4, must get points Average: From 10 - 12 , 5 points; criteria 1, 4 must get points Weak: Total points are 10 points TOTAL ... Results (2 points) 10 Most students understand and master the focus of the lesson; how to apply the knowledge into real situations (2 points) LESSON RANKING: OBSERVER (signature) Good: From 17 -20 points; ... - The teacher starts the lesson clearly - The teacher uses the lesson plan appropriately - The teacher uses a good balance of English and Vietnamese - There are clear stages to the lesson - the...
Ngày tải lên: 07/09/2013, 13:45
Tài liệu Đàn tính The Marvelous and Sarced Musical Instrument of the Tay People- La Công ý pptx
... the drum in many shamanic cultures, the stringed đàn tính enables the work of the Then and their spirit familiars Then say that their spirits will only descend when they hear the music from the ... touch the instrument For their part, most lay people avoid the sacred đàn tính Even the Then say that they la: sacred musical instrument of the tày people | 28 1 were hesitant to touch the đàn ... the pot in the steam and later figure Mrs Mỗ Thị Kịt and her apprentices perform at the vme (in 20 04?) La Công Ý, Vme archive 28 2 | Asian Ethnology 67 /2 • 20 08 figure The first festival of Then...
Ngày tải lên: 10/12/2013, 04:15
Tài liệu THE ELDERLY AND MOBILITY: A REVIEW OF THE LITERATURE pdf
... 5737.5 14 3 12 . 0 12 3 13 .5 320 9.5 12 8 2.5 21 5.0 A&E transfers per 10 0 million driver miles 45.64 10 .33 6.44 8.09 16 .34 25 .29 Excess A&E transfers (relative to the 35-39 years age group) 4 927 .4 5390.9 ... from the research – the low mileage bias 17 2. 1. 3 .1 Explaining the low mileage bias 19 2. 1. 4 Conclusions 20 2. 2 VULNERABILITY 20 2. 2 .1 Findings from the OECD ... SAFETY: THE FACTS AND MYTHS 13 2. 1 CRASH INVOLVEMENT 13 2. 1. 1 Findings from the OECD Working Group 13 2. 1 .2 Findings from the research – the frailty bias 15 2. 1. 3...
Ngày tải lên: 13/02/2014, 18:20
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf
... 4 ,13 4 1, 583 714 68,687 18 , 328 15 , 12 2 10 ,9 12 9, 411 4,335 3,087 2, 295 42, 006 16 ,22 7 6,803 329 ,5 62 10 9,8 41 71, 7 01 20 ,24 0 25 , 12 8 21 ,4 12 21, 454 20 ,085 7 ,28 2 9, 615 1, 984 1, 627 9 ,26 6 11 ,24 2 6,586 11 , 0 21 ... 7 ,20 7 1, 936 96,045 43,780 18 ,24 1 22 % 49% 53% 19 % 30% 15 % 42% 31% 13 % 32% 22 % 28 % 21 % 19 % 18 % 47% 8% 11 % 10 % 19 % 20 % 17 % 16 % 9% 26 % 20 % 65% 24 % 24 % 29 % 17 % 12 % 11 % 10 % 14 % 13 % 12 % 13 % 12 % 8% 16 % 11 % ... 44% 22 % 27 % 23 % 25 % 29 % 31% 12 % 14 % 28 % 33% 47% 45% 18 % 21 % 20 % 15 % 36% 35% 10 % 17 % 30% 31% 18 % 18 % 20 % 19 % 12 % 11 % 29 % 32% 5% 8% 16 % 17 % 12 % 21 % 14 % 16 % 3% 4% 15 % 13 % 16 % 25 % 21 % 18 % 26 % 28 % 16 %...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... mediated by the sequence VH2-N (Fig 4A) 817 364 364 C-Vrp1p465- 817 C-Vrp1p493- 817 C-Vrp1p533- 817 C-Vrp1p 614 - 817 C-Vrp1p760- 817 817 C-Vrp1p 716 - 817 817 817 465 817 493 817 533 533 817 614 716 817 760 ... YCplac 111 expressing C-Vrp1p364) 817 E692A under VRP1 promoter YCplac 111 expressing C-Vrp1p364) 817 K740A under VRP1 promoter YCplac 111 expressing C-Vrp1p364) 817 W782A under VRP1 promoter YCplac 111 ... YCplac 111 expressing C-Vrp1p364) 817 D502AK503A under VRP1 promoter YCplac 111 expressing C-Vrp1p364) 817 K 512 AD 513 A under VRP1 promoter YCplac 111 expressing C-Vrp1p364) 817 D594AK595A under VRP1 promoter...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... B et al (20 03) The conditional inactivation of the beta-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility J Cell Biol 1 62, 11 11 1 12 2 Lindblom ... in mice J Cell Physiol 20 2, 23 0 23 9 12 Ichaso N & Dilworth SM (20 01) Cell transformation by the middle T–antigen of polyoma virus Oncogene 20 , 7908–7 916 13 Jat PS & Sharp PA (19 89) Cell lines ... by these cells Bar = 50 lm (D, right panel) or 20 0 lm (all other panels) FEBS Journal 27 5 (20 08) 19 88 19 98 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 19 91 A new method for mouse endothelial...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx
... (lM )1 s )1) 0 .1 0 .2 1 19 15 28 24 0. 32 0 .26 0.65 0.55 ± ± ± ± k )1 (s )1) 0. 02 0 .29 0. 01 0.58 0.08 0 .26 0.04 0.0 62 Kd (lM) ± ± ± ± 0.03 0.03 0. 02 0.006 0.88 2. 3 0.4 0 .11 molecules NP and MP are the ... (MHHHHHH) at the N-terminus The Kd values were calculated as k )1 ⁄ k1 SaDHNA EcDHNA k1 (lM )1 s )1) NP MP HP HPO k )1 (s )1) 0 .24 0 .29 0.47 0.45 4.5 4 .2 13 10 ± ± ± ± 0. 01 0. 02 0.04 0. 02 ± ± ± ± Kd ... Journal 27 4 (20 07) 22 40 22 52 ª 20 07 The Authors Journal compilation ª 20 07 FEBS Y Wang et al Fig Global analysis of the quench-flow data of the SaDHNA-catalyzed reaction Data 1, 2, 3, 7, 8, and 11 were...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... L99A E103Q E103A R104A R105A F 118 A G 12 1 A Y154S F169A P172A T208A P209A D 211 N D 211 A L 225 A Sequence 5’ to 3’ Substitution G2A F W7P F I12P F V16G F F20A F G21A F K24A F L25A F G33A F F39A F K37Q F ... 3Pro3Gly I12P 3Pro6Gly F20A G21A K24A L25A G33A F39A 3K > Q TatB mutants E8Q E8A 3Gly V12P G21A P22G P22L L25A P26A L63A 2R > N 3K > Q TatC mutants P48A I81M P85A F94A P97A L99A E103Q E103A R104A R105A ... P48A F I81M F P85A F F94A F P97A F L99A F E103Q F E103A F R104A F R105A F F 118 A F G 12 1 A F Y154S F F169A F P172A F T208A F P209A F D 211 N F D 211 A F L 225 A F ggtatccgcggcattgatcaagcagttg ggtgtcgctgatgctgtcagcgccg...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo " On equations of motion, boundary conditions and conserved energy-momentum of the rigid string " doc
... Science, Mathematics - Physics 24 (20 08) 11 1 -11 8 11 7 Using Hamilton equations of motion (47) we may write dF = dt ¯ ¯ ¯ ¯ ¯ ∂F ∂F ˙ ∂ F ˙′ ∂F ∂F q1 + ′ q 1 + ˙ p1 + ˙ p2 ˙ q2+ ∂q1 ∂q1 ∂q2 ∂p1 ∂p2 π ... ∂ ∂F ′ − ∂σ ∂q1 = ( 51) δF δF δF δF q1 + ˙ q2 + ˙ p1 + ˙ p2 + ˙ δq1 δq2 δp1 δp2 σ=π ¯ ∂F ∂q 1 + q1 ˙ σ=0 ∂F q1 ˙ ∂q 1 σ=π + σ=0 ¯ ∂F ˙ ′ q2 ∂q2 σ=π ( 52) σ=0 Equation (50) has a rather usual implication ... Physics 24 (20 08) 11 1 -11 8 11 4 is constant during the τ -evolution We notice that the two last terms on the right hand side of formula π (19 ) cancel with the term dσ 1 ( ∂∂L ) Therefore the final...
Ngày tải lên: 05/03/2014, 14:20
Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
... 0.09 1. 41 0. 02 0. 51 0. 02 0 .10 0. 02 1. 00 0.05 0. 314 0.034 ND 0 .18 0. 02 0 .11 4 0.0 12 1 .25 0.46 1. 04 0 .13 2. 22 0 . 21 0 .17 0. 02 0. 12 7 0 12 1. 83 0.04 0.90 11 6 .28 0.34 0.376 0.03 1. 92 20.4 ... 1. 1 0.7 1 .23 0 .22 0.6 32 0 .27 0.380 0.0 02 0.336 0. 015 2. 04 0.08 1. 04 0.30 2. 24 0.77 0.336 0.05 0 .22 4 ND ND ND ND 2. 19 0 .11 3 0.3 71 0.3 82 1. 05 2. 70 0 .1 32 0.339 0 .22 9 2. 85 17 3 81. 7 12 5 62 ... 0. 01 2. 21 0.46 22 22 .7 0.5 19 .5 1. 9 10 .0 0.8 20 6 8.83 0.45 3 .2 0.4 1. 65 0 .11 3 .1 0.3 8 .2 E)3 E)4 0.030 0.0 01 0 .28 3 1. 3 E )2 0.0 026 0. 018 0.0 91 79 20 0 4 91 4.9 FEBS Journal 27 8 (20 11 ) 24 6 024 68...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Substrate preference and phosphatidylinositol monophosphate inhibition of the catalytic domain of the Per-Arnt-Sim domain kinase PASKIN ppt
... et al (20 03) Targeted disrup- FEBS Journal 27 8 (20 11 ) 17 57 17 68 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 17 67 Targets and stimulation of PASKIN 15 16 17 18 19 20 21 22 23 24 25 P Schlafli ... FEBS Journal 27 8 (20 11 ) 17 57 17 68 ª 20 11 The Authors Journal compilation ª 20 11 FEBS P Schlafli et al ¨ serines of S6, starting with S236 and S235 (i.e the same sites as shown in the present study ... by PS or phosphatidylcholine (PC), although all other FEBS Journal 27 8 (20 11 ) 17 57 17 68 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 17 61 Targets and stimulation of PASKIN P Schlafli et...
Ngày tải lên: 06/03/2014, 00:21
Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx
... colon Page 20 of 21 (page number not for citation purposes) Nutrition Journal 20 04, 3 :19 20 5 20 6 20 7 20 8 20 9 21 0 21 1 21 2 21 3 21 4 21 5 21 6 21 7 21 8 21 9 22 0 22 1 22 2 22 3 22 4 cancer in women in the Nurses' ... http://www.nutritionj.com/content/3 /1/ 19 18 5 18 6 18 7 18 8 18 9 19 0 19 1 1 92 19 3 19 4 19 5 19 6 19 7 19 8 19 9 20 0 20 1 20 2 20 3 20 4 Adipose tissue omega-3 and omega-6 fatty acid content and breast cancer in the EURAMIC study ... Acres Foundation http://www.nutritionj.com/content/3 /1/ 19 23 24 References 10 11 12 13 14 15 16 17 18 19 20 21 22 WCRF/AICR: Food, nutrition and the prevention of cancer: a global perspective: World...
Ngày tải lên: 06/03/2014, 02:21
CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot
... Size: ft 2- 1 /2 in by ft 7 -1 /2 in 11 and 12 Apostles and Genii, and St John the Baptist Frescoes in the Cathedral of Parma Painted 1 524 -15 30 13 Christ appearing to Mary Magdalene in the Garden ... 18 9 -19 5) July, 1 5 21 -Spring, 1 522 In Correggio (pp 19 4, 19 5), and probable execution of the Ecce Homo, Christ in Garden, and Noli me tangere (p 22 6) 1 5 21 Birth of son Pomponio, September (p 18 5).[xiv] ... Francis (p 94) 15 18 In Parma executing the frescoes of San Paolo, April-December (p 1 52) 1 520 Invitation to Parma from the Benedictines (p 15 3) Marriage with Girolama Merlini (p 18 5) 1 520 -1 525 At work...
Ngày tải lên: 06/03/2014, 13:20
Báo cáo khoa học: Identification of the amniotic fluid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms docx
... 26 + 16 + 15 + 13 + 14 + D 25 493 Da 21 + 20 + 22 + 19 + 18 + 23 + 17 + 16 + 25 + 24 + 22 + 13 + 14 + C 25 410 Da 21 + 20 + 19 + 18 + 23 + 25 + 15 + 17 + 16 + 15 + 13 + 14 + 24 + B 21 + 20 + 19 + 22 + 16 + 18 + 23 + 25 + 17 + 15 + 24 + 14 + ... +P Glu C peptides 83 -10 8 +2P 93 -10 0 +P 93 -10 3 +P 93 -10 3 +2P 93 -10 8 +P 10 0 -11 1 +P 10 9- 12 1 +P 10 9- 12 2 +P 1 12 - 12 1 +P 11 3- 12 1 +P 16 1 -1 72 +P Tryptic peptides 16 5 -17 5 +P 16 5 -18 3 +P Sequence Calculated ... SLAKAQETSGEE 27 87 .1 853.4 11 69.4 12 4 9.4 17 70.7 13 57.6 15 94.7 17 08.7 12 5 3.5 11 39.4 13 30.0 27 87.8 853 .2 11 69.3 12 4 9 .2 17 71. 4 13 57.6 15 95 .2 17 08.6 12 5 3.9 11 39.9 13 30.3 +0.7 )0 .2 )0 .1 )0 .2 )0.3 )0.5 )0 .1 +0.4...
Ngày tải lên: 07/03/2014, 00:20