prins and in situ pcr protocols

Introduction The technique for labeling chromosomes by annealing an oligonucleotide DNA primer to the denatured DNA of chromosome preparations on glass slides and extending it enzymatic

1

Oligonucleotide PRINS DNA Synthesis

John R Gosden and Diane Lawson

1 Introduction

The technique for labeling chromosomes by annealing an oligonucleotide DNA primer to the denatured DNA of chromosome preparations on glass slides and extending it enzymatically in situ with the incorporation of labeled nucleotides was fust described by Koch et al in 1989 (I) Since then, the technique has been greatly improved in reliability, sensitivity, and resolution, and now provides a viable, rapid alternative to conventional fluorescence in situ hybridization (FISH) for many investigations, particularly the identification of chromosome aneuploidy in metastatic tissues and antenatal diagnosis and the analysis of the human chromosome complement of somatic hybrid cell lines (Zd)

2 Materials

2.1 Primed In Situ Syf7thesis

1 Twin-Frost glass slides and 22 x 40 mm coverslips: The slides must be cleaned

by soaking in ethanol to which a few drops of HCl have been added, followed by polishing with a clean piece of muslin, before the cells are deposited on the slide Coverslips must be cleaned in the same way before use

2 PRINS buffer (10): 500 mM KCl, 100 mil4 Tris-HCl, pH 8.3, 15 mA4 MgC12, 0.1% BSA

3 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia Biotech, St Albans, UK), diluted 1: 10 with sterile distilled HzO

4 2’-Deoxycytidine 5’-triphosphate (dCTP): 1 00-mM solution (Pharmacia Biotech) diluted 1: 10 with sterile distilled H20

5 2’-Deoxyguanosine S-triphosphate (dGTP): 100~mM solution (Pharmacia Biotech) diluted 1: 10 with sterile distilled H20

6 2’-Deoxythymidine 5’-triphosphate (dTTP): lOO-mJ4 solution (Pharmacia Biotech) diluted 1: 100 with sterile distilled H,O

From Methods fn Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols

Ed&d by J R Gosden Humana Press Inc., Totowa, NJ

2 Gosden and Lawson

7 Biotin-16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim, Lewes, Sussex, UK)

8 Digoxigenin-1 I-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehrmger Mannherm)

9 FluoroRed (Amersham International, plc, Buckinghamshire, England)

10 FluoroGreen (Amersham International)

11 FluoroBlue (Amersham International)

12 Ohgonucleotide primer(s) at 250 ng/pL (see Note 1)

13 Tuq DNA polymerase (Taq [Boehrmger], AmpliTaq [Cetus], or ThermoprimePrus [Advanced Biotechnologies Ltd., Leatherhead, England])

14 Rubber cement (vulcanizing solutron) (e.g., Tip-Top, Stahlgruber, DS-8011 Poing, Germany) (see Note 2)

15 Stop buffer (500 mM NaCl, 50 n1J4 EDTA)

16 Flat-bed thermal cycler (see Note 3)

17 Water bath at 65°C

2.2 Detection

1 Dried skimmed milk powder

2 Avrdin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlin- game, CA)

3 Avidin-DCS-Texas red (Av-TR) (Vector Labs)

4 Antrdigoxigenin-fluorescem (anti-DIG-FITC) (Boehrmger Mannhelm)

5 Antrdigoxigenm-rhodamine (anti-DIG-rhodamine) (Boehrmger Mannheim)

6 Propidium iodide (20 pg/mL) (Sigma)

7 4’,6-Dtamidino-2-phenylmdole 2 HCl (DAPI) (100 pg/mL) (Sigma)

8 VectaShreld (Vector Labs)

9 20X SSC: 3.OMNaC1, 0.3OMtn-sodmm citrate, pH 7.3

10 Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Tnton X-100

11 Blocking buffer: wash buffer with the addition of 5% skimmed mrlk powder

12 Incubator or water bath at 37’C and water bath at 45°C

13 Microscope equipped for eprfluorescence (e g., Zeiss Axioskop or Leitz Ortholux

II with Pleomopak filter system)

3 Methods

3.1 Standard PRINS

1 You will need cells or chromosomes, prepared from peripheral blood lym- phocytes (71, cultured cells (8), or frozen sections (see Speel et al., Chapter 8) (see Note 5)

2 Oligonucleotide primers are prepared on an Applied Biosystems (Foster City, CA) Model 38 1A DNA synthesizer according to the manufacturer’s instructions Recommendations for some successful chromosome-specific primers are given

in Table 1 (but see Note 4)

3 The reaction mix is made up as follows: For each slide, put 1 pL of each of the diluted nucleotide triphosphates, plus 1 @L of the selected labeled dUTP (biotin,

PRINS 3 Table 1

TTCTTTTCATACCGCATTCT ATTGCACTTCTTTGAGGAGTACCG TAGTAA

AATCAACCCGAGTGCAATC CTTCGTTGGAAACGGGA

digoxigenin, or a fluorochrome), 5 pL 10X PRINS buffer, and 1 pL of the appro- priate oligonucleotide pruner (see Note 6) mto a microcentrifuge tube, and add distilled water to 50 PI.,,

4 Mix thoroughly and add 1 U of your chosen DNA polymerase Mix carefully and place 40 $ on a clean coverslip

5 Pick the coverslip up with a slide (this spreads the reaction mix evenly, with the least risk of introducing air bubbles) and seal with rubber cement

6 Dry the seal (a cold air fan is quick and safe) and transfer the slides to the flat block of a thermal cycler A suitable basic program for the Hybaid OmniGeneTM

In Situ, or Hybaid OmniSlideTM is 93”C, 3 min; 60°C 5-10 min; 72”C, 15 min

7 On completion of the program, remove the seal (it peels off easily by rubbing one comer) and transfer the slides for 1 min to a Coplin jar containing stop buffer at 65°C Leave the coverslips in place, unless they come off readily with the seal; they will in any case fall off in the stop buffer After 1 min, transfer the slides to

a stain dish containing wash buffer They may be held in this solution overnight

if convenient (but see Note 7)

3.2 Detection

It is important that the slides do not become dry at any time during this process The following steps apply only to slides in which the PRINS reaction has been labeled with biotin or digoxigenin Slides in which the reaction used a fluorochrome-dUTP as the label require no detection step, and are simply mounted (see step 6)

1 Prepare blocking buffer The milk powder dissolves rapidly if the solution is warmed to 45“C for a few seconds

2 Put 40 pL blockmg buffer on a clean coverslip, shake surplus wash buffer from the slide, and pick up the coverslip containing blocking buffer Leave (unsealed)

at room temperature for 5 min

3 Dissolve reporter (avidin-fluorochrome or antidigoxigenin-fluorochrome) in block- ing buffer For Av-FITC or Av-TR, 1:500 is a suitable dilution; anti-DIG FITC and anti-DIG rhodamine are better at 1: 100 dilution Make sufficient buffer for a

40 &/slide Spin in a microcentrifuge for 5 min This precipitates any aggregates that may have formed during storage and can cause high and nonspecific background

4 Go&en and Lawson

4 Remove the cover&p from the slide, shake surplus fluid off both the sltde and the coverslip, and add 40 pL of reporter solution to the same coverslip Replace the slide and incubate in a moist chamber (e g., a sandwich box lmed with damp filter paper) at 37°C for 30 mm

5 Warm a reagent bottle containing wash buffer to 45OC in a water bath Remove covershps and wash slides 3 x 2 min in 50 mL wash buffer at 45°C

6 After the final wash, shake off surplus fluid and mount slides in VectaShleld containing the appropriate counterstain: For slides labeled with rhodamine or Texas red, this should be DAPI (5 pg/lOO pL VectaShield, i e., 5 pL of DAPI stock/l00 pL VectaShleld); for slides labeled with FITC, this should be a propidium iodide/DAPI mixture (3.75 & of each stock/l00 pL VectaShield) Use 20-30 pL mountant/slide, blot surplus by covering slide and covershp with a tissue and pressing gently to expel excess mountant, and seal with rubber cement Slides may be stored m the dark at 4°C for several months If the stain shows signs of fading, simply peel off the sealant, soak the slide overnight in 4X SSC, 0.05% Triton X-100 (the covershp will fall off at this point), and remount as above Figure 1 shows some typlcal results

7 Multiple sequential PRINS reactions may be performed on the same sample in order to quantify a number of chromosomes For details of the method, see Chap- ter 6 and ref 6

8 The technique may also be combined with FISH After the stop buffer, the shdes are passed through an ethanol series (70, 90, 100%) and air-dried before per- forming a normal FISH procedure, omitting any denaturation of the chromo- somal DNA Detection of the PRINS product and the hybridized FISH probe is then performed simultaneously (9) This provides a rapid method for identifying the chromosomal target located by the FISH

4 Notes

1 Oligonucleotide pnmers can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol preclpltatlon and washing If this facility is not available, they may be obtained from commercial sources, but purification steps, such as HPLC, are not needed and only increase the cost of the product

2 The requirement for a suitable seal is that it should be reasonably robust, provide

a vapor-tight seal, and be easily and completely removed at the end of the proce- dure We have found that Tip-Top fulfills all these parameters and is readily available from bicycle repair shops

3 Thermal cyclers with a flat bed for microscope slides are not yet widely avall- able Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines designed for PCR in microtubes, with a plate added to the heated block Thermal transfer and temperature control m such a system are rarely satisfactory The procedure can be carried out by transferrmg slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precise, and the temperature drop during the

PRINS

Fig 1 (see color plate number 1 after p 82) Examples of PRINS reactions with the primers shown in Table 1 All reactions were labeled with biotin-16-dUTP, and the label detected with avidin-FITC Chromosomes were counterstained with a mixture of DAPI and propidium iodide (A) Chromosome 16 (B) Chromosome 9 (C) Chromo- some 17 (D) CenP-B box primer (labels all centromeres)

transfer from water bath to water bath leads to high backgrounds The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively

4 As an alternative, complete systems for chromosome identification by PRINS are becoming available (e.g., Advanced Biotechnologies, Leatherhead, England)

5 Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for several months Slides are prepared fresh each week by gently centrifuging the suspension to precipitate the cells, resuspending in fresh fix, repeating this pro- cess, and finally resuspending in sufficient fix to give a suitable density and put- ting one drop on a clean slide, which is allowed to dry at room temperature The balance of the suspension may then be diluted suitably with fix and returned

to -2O’C Using slides more than l-2 wk old can be successful, but may lead to reduced sensitivity and greater variability

6 The majority of chromosome-specific alphoid sequences produce adequate sig- nal with a single primer at a concentration of 250 ng/50 l.tL reaction In some

Go&en and Lawson

cases, a clearer signal with less background may be produced with paired pnm- ers, at the same concentration, whereas in others, the concentration of primer may be reduced, with a concomitant reduction in crossreaction to related chro- mosomal sequences

7 Slides that have been labeled directly with fluorochromes may still be held m this solution overnight if convenient, but should be kept in the dark to prevent bleach- ing and fading of the label

References

1 Koch, J E., Kolvraa, S., Petersen, K B., Gregersen, N., and Bolund, I (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ Chromosoma 98,259-265

2 Gosden, J., Hanratty, D., Starling, J., Fantes, J , Mitchell, A., and Porteous, D (199 1) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chro- mosome mapping, banding and investigation of sequence organization Cytogenet CeEZ Genet 57, 100-l 04

3 Gosden, J and Lawson, D (1994) Rapid chromosome identification by ohgo- nucleotide primed in situ DNA synthesis (PRINS) Hum A401 Genet 3,93 l-946

4 Gosden, J and Lawson, D (1995) Instant PRINS: a rapid method for chromo- some identification by detecting repeated sequences in situ Cytogenet Cell Genet 68,57-60

5 Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C A., Kolvraa, S., and Bolund, L (1994) Fast, sensitive multicolour detection of nucleic acids by primed in situ labelling (PRINS) Cytogenet Cell Genet 66, 152-l 54

6 Speel, E J M., Lawson, D., Hopman, A H N., and Gosden, J (1995) Multi- PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reac- tions label specific chromosomes and produce bands Hum Genet 95,29-33

7 Spowart, G (1994) Mitotic metaphase chromosome preparation from peripheral blood for high resolution, in Methods in Molecular Biology, vol 29 Chromosome Analyszs Protocols (Gosden, J R., ed.), Humana, Totowa, NJ, pp l-10

8 Fletcher, J (1994) Immortalized cells lines: chromosome preparation and bmd- ing, in Methods in Molecular Bzology, vol 29: Chromosome Analyszs Protocols (Gosden, J R., ed.), Humana, Totowa, NJ, pp 51-57

9 Warburton, P E., Haaf, T., Gosden, J., Lawson, D , and Willard, H F (1996) Characterization of a chromosome-specific chimpanzee alpha satellite subset: evolutionary relationship to subsets on human chromosomes Genomlcs 33,220-228

(1) or the use of a DNA probe to detect specifically a region of the chromo- some by fluorescence in sztu hybridization (FISH) (2) The use of centromeric

a satellite sequences as FISH probes is very popular because of the specificity

of these sequences cz Satellite (or alphoid) DNA 1s a family of tandemly repeated sequences present at the centromere of all human chromosomes (3) Subfamilies, some of them specific for one or a small group of chromosomes, can be identified within alphoid DNA both by the periodic distribution of restriction sites and the nucleotide sequence of the 171-bp basic motif (4) These chromosome-specific subfamilies can therefore be used as FISH probes This approach is limited, however, since the DNA sequences of some subfami- lies are very close to each other, and crosshybridization can occur between the centromeric sequences of several pairs of chromosomes This is the case with chromosomes 13 and 2 1, for example, which share 99.7% homology in their alphoid sequences (5, The development of the primed in situ (PRINS) tech- nique of labeling DNA (68) introduced a solution to this problem The PRINS procedure consists of the use of a small oligonucleotide (usually 18-22 nucle- otides) from the sequence of interest as a primer The primer is annealed to the denatured DNA of a chromosome or cell preparation An in situ DNA synthe- sis reaction is performed with the incorporation of a labeled precursor (biotin- dUTP or digoxygenin-dUTP), using a thermostable DNA polymerase A single

From Methods m Molecular B/otogy, Vol 71 PRlNS and In S~tu PCR Protocols

Edlted by J R Gosden Humana Press Inc., Totowa, NJ

7

8 Charlieu and Pellestor

base mismatch between the target and the probe will produce a less stable hybrid when using a primer than for a long FISH probe In addition, if the mismatching nucleotide is located at the 3’-end of the PRINS primer, it will prevent any elongation by the DNA polymerase

We have developed several chromosome-specific a-satellite primers for PRINS, each of them carrying at least a chromosome-specific nucleotide at its 3’-end, and we describe in this chapter the use of two of them for the detection

of human chromosomes 13 and 21 Other primers are available in the literature (9,ZO) or on request, but we are presenting only the conditions of use for the two most difficult, differing only at one position

2.2 PRIM Reaction

1 Primers: Synthetic oligonucleotides are used as primers m the PRINS experi- ments Their nucleotide sequences are as follows (11):

13A (chromosome 13): 5’-TGATGTGTGTACCCAGCT-3’

21A (chromosome 21): 5’-TGATGTGTGTACCCAGCC-3’

Precipitate the primers by adding 10 vol of 1-butanol, vortex, and centrifuge for

1 mm at maximum speed in a bench-top microfuge Dry the pellets under vacuum, and resuspend in 5 miV Tris-HCl, pH 8.0, to obtain a 50 @4 (50 pmol/pL) solu-

tion Store small aliquots (50 pL) at -2OT (see Notes 1 and 2)

2 2’-Deoxyadenosine 5’-triphosphate (dATP) (Boehringer Mannheim, Meylan,

France): Resuspend in Hz0 to obtain a 100-M stock solution (store at -2O’C)

3 2’-Deoxycytosine 5’-triphosphate (dCTP) (Boehringer Mannheim): Resuspend to

obtain a 100~mM stock solution (-2O’C)

4 2’-Deoxyguanosine 5’-triphosphate (dGTP) (Boehringer Mannheim): Resuspend

to obtain a 100~mM stock solution (-2OT)

5 2’-Deoxythymidine 5’-triphosphate (dTTP) (Boehringer Mannheim): Resuspend

to obtain a 100-n&f stock solution (-20°C)

6 Biotin-l&dUTP, 1 mM (Boehringer Mannheim) (-2O’C)

7 Glycerol 87% (Prolabo)

8 Tuq DNA polymerase (Boehringer Mannhetm) Store at -2O’C

9 10X Taq buffer (provided with the enzyme) (-2O’C)

1 Washing solution: 4X SSC, 0.05% Tween 20

2 Blocking solution: washing buffer plus 5% nonfat dry milk Make fresh each time

3 Fluorescein-avidin DCS (FITC-avidin) (Vector Laboratories, Burlingame, CA)

4 Propidium iodide (PI) (Sigma)

5 Antifade solution Vectashield (Vector Labs)

3.2 PRINS Reaction

1 Prepare a 10X dNTPs mix: Dilute the stock solutions (100 r&f) of dATP, dCTP, dGTP, and dTTP l/l 0 in sterile, distilled water In a sterile microcentrifuge tube, mix 10 & of each diluted dATP, dCTP, and dGTP, 0.25 pL of diluted dTTP, 25 pL

of 1 m&f biotin-16 dUTP, and 55 pL of glycerol Mix well and store at -2O’C

2 Prepare the PRINS reaction mix in a sterile 1.5~mL microtube by mixing (for each slide) 4 pL of primer (200 pmol), 5 pL of 10X Tag polymerase buffer, 5 pL

of 10X dNTPs mix (from step l), and 0.5 pL of Taq polymerase (2.5 U), and add sterile distilled water to a final volume of 50 pL

3 Preheat the reaction mix at 60°C in a water bath

4 Place the slide (prepared as in Section 3.1.) and a coverslip on the plate of the thermal cycler

5 Set up the program for PRINS: 12 min at the annealing temperature (60°C for primer 13A, 61°C for primer 21A; see Note 4) and 30 min at 72’C

6 When starting the program, heat the slide(s) and the coverslip at the anneal- ing temperature for 5 min Then put the reaction mix onto the slide and cover

10 Char-lieu and Pellestor

by the coverslip Incubate the slide at the annealing temperature for a further

7 min; the temperature is automatically raised to 72°C at the beginning of the elongation step

7 At the end of the elongation time, transfer the slide to 100 mL of preheated stop buffer (72°C) for 3 min to stop the PRlNS reaction and to remove the coverslip Then transfer the slide to 100 mL of washing solution The shdes can stay m thus buffer overnight at 4°C if convenient

3 Incubate for 10 min at room temperature under a coverslip

4 Remove the covershp, dram excess fluid, and apply 100 pL of FITC-avldin diluted to 5 pg/mL in blocking solution to the slide Cover with a new coverslip and incubate at 37°C for 30 min in a moist chamber

5 Remove the coverslip and wash the slide three times (5 mm each) m washmg solution, at room temperature, with gentle agitation

6 Drain excess fluid and mount the slide (22 x 40 coverslip) with Vectashleld antifade solution containing 0.5 l.tglmL propidium iodide

7 Examine the shde by fluorescence microscopy (Fig 1)

4 Notes

1 Chromosome-spectfic primers sometimes differ from each other by only one nucleotide at the 3’-end, as for the primers described here It is therefore advtsable

to purify the primers by HPLC to avoid contammation by shorter products am+

mg from premature stops during syntheses Storage of the primers in small aliquots also prevents degradation of the primers by repeated cycles of freeze-thawing

2 The concentration of the primers can be determined by using the Beer-Lambert equation:

c = A26d%mi x L (1)

where C is the concentration (M), A260 is the absorbance at 260 nm, E,,,~~ is the molar extinction coefficient (M-l), and L is the path length (cm) of the spectro- photometer cuvet The molar extinction coefficient for an oligonucleottde can be determined as follows:

& max = (number of A x 15,200) + (number of C x 7050) +

(number of G x 12,010) + (number of T x 8400) M-l (2)

3 We describe here formamide denaturation, which gave more consistent results in our hands, but it is also possible to denature the chromosomes by heating the slide at 95“C for 3 min as part of the thermal cycle In this case, omit step 3 of Section 3.1.) and run the following program on the PCR machine: 95°C for 3 min,

Chromosome-Specific PRINS 11

Fig 1 PRINS detection of chromosomes 13 (A) and 21 (B) The detection was per- formed according to the protocol described in the text The chromosomes were coun- terstained with propidium iodide Arrows indicate the chromosome-specific signals

annealing temperature for 7 min, and 72°C for 30 min The preheated reaction mix is added after the initial denaturation step

4 The annealing temperature was determined empirically for each primer, and those described here were found to give specific labeling in our hands with our PCR machine and in our laboratory However, slight adjustments may be necessary if these primers are to be used in other laboratories, since each PCR machine may have a different thermal response curve The conditions described here must therefore be taken as indications only, and not as absolute rules When testing new PRTNS primers, a good start for the annealing temperature is 5°C under the empirically determined melting temperature (T’,) of the primer: 4°C x (G + C) +

12 Charlieu and Pellestor

2°C x (A + T) The annealing temperature is then modified according to the sig- nal and/or the specificity obtained

References

1, Sumner, A T (1994) Chromosome banding and identification: absorption stain-

mg, m Methods in Molecular Bzology, vol 29, Chromosome Analysis Protocols

(Gosden, J R., ea.), Humana, Totowa, NJ, pp 5%81

2 Lichter, P and Ried, T (1994) Molecular analysis of chromosome aberrations: in situ hybridization, in Methods in Molecular Biology, vol 29, Chromosome Analy- szs Protocols (Gosden, 3 R., ed.), Humana, Totowa, NJ, pp 449-478

3 Choo, K H,, Vissel, B., Nagy, A., Earle, E., and Kalitsis, P (1991) A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence Nuclezc Aczds Res 19, 1179-I 182

4 Willard, H F and Waye, J S (1987) Hierarchical order in chromosome-specific human alpha satellite DNA Trends Genet 3, 192-198

5, Jorgensen, A L., Bostock, C J., and Bak, A L (1987) Homologous subfamilies

of human alphoid repetitive DNA on different nucleolus organizing chromosomes

Proc Natl Acad Scz USA 84, 1075-1079

6 Koch, J E., Kolvraa, S., Petersen, K B., Gregersen, N., and Bolund, L (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ Chromosoma 98,259-265

7 Gosden, J and Lawson, D (1994) Rapid chromosome identification by oligo- nucleotide-primed in situ DNA synthesis (PRINS) Hum Mol Genet 3,93 l-936

8 Pellestor, F., Girardet, A., Lefort, G., Andrea, B., and Charlieu, J.-P (1995) Rapid

in situ detection of chromosome 2 1 by PRINS technique Am J Med Genet 56, 393-397

9 Pellestor, F., Girardet, A., Andrea, B., Lefort, G., and Charlieu, J.-P (1994) The use of PRINS technique for a rapid in situ detection of chromosomes 13, 16, 18,

21, X and Y Hum Genet 95,12-17

10 Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J.-P (1995) Selection of chromosome specific primers and their use in simple and double PRINS technique for rapid in situ identification of human chromosomes

Cytogenet Cell Genet 70, 138-142

11 Charlieu, J.-P., Murgue, B., Marcais, B., Bellis, M., and Roizes, G (1992) Dis- crimination between alpha satellite DNA sequences from chromosomes 21 and

13 by using polymerase chain reaction, Genomics 14,5 15,5 16

3

Bright-Field Microscopic Detection

of Oligonucleotide PRINS-Labeled DNA

in Chromosome Preparations

Ernst J M Speel, Diane Lawson, Frans C S Ramaekers,

John R Gosden, and Anton H N Hopman

1 Introduction

Primed dn situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences m cell (I-4) and tissue preparations (5; see also Chapter 5) In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequence in situ The primer serves as an initiation site for in situ chain elongation using a thermostable DNA polymerase and labeled nucleotides, which can be detected directly by fluorescence microscopy, such

as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxi- genin-dUTP and the application of fluorochrome-conjugated avidin or anti- body molecules (3,6,7) The detection limit of the PRINS technique appears to

be on the order of low-copy sequences (3,8’

Recently, multiple-target PRINS approaches were reported using sequential PRINS reactions with differently modified nucleotides combined with fluores- cence detection (6,7,9) For the simultaneous identification of more than two DNA sequences, however, DNA counterstaining or chromosome banding is in principle not possible, since the available fluorescence colors are utilized for specific target detection

Here we describe a bright-field microscopic procedure for the simultaneous detection of up to three different PRINS-labeled DNA target sequences in con- trasting colors in both interphase and metaphase cells (Fig lA,B) DNA sequences were detected by the precipitates of the horseradish peroxidase- diaminobenzidine (PO-DAB, brown color), alkaline phosphatase-fast red

From Methods m Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols

Edited by* J R Gosden Humana Press Inc , Totowa, NJ

13

Speel et al

Fig 1 (see color plate number 2 after p 82) (A) Bright-field detection of chromo- some 9 and 7 centromeres with biotin/PO-DAB (brown) and digoxigenin/APase-fast red (red), respectively, in a human lymphocyte metaphase spread after double-target PRINS, hematoxylin counterstaining and PBS/glycerol (1:9) embedding (B) Bright- field detection of chromosome 9,7, and Y centromeres with biotin/PO-DAB (brown), digoxigenin/APase-fast red (red), and fluorescein/PO-TMB (green), respectively, in a human lymphocyte metaphase spread after triple-target PRINS, hematoxylin counter- staining and BSA/formaldehyde embedding

(APase-fast red, red color), and horseradish peroxidase-tetramethylbenzidine (PO-TMB, green color) Chromosomes and nuclei were counterstained with hematoxylin before bright-field microscopical visualization Such an approach, which had been first described for ISH (IO), has the advantage that no fluores- cence microscope with a confocal system or CCD camera for image analysis and processing is required Furthermore, no fading of the in situ enzyme pre- cipitation products occurs since they are permanently localized

2 Materials

2.1 PRINS DNA Labeling

1 Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100 mJ4 solutions of dATP, dCTP, dGTP, and dTTP

2 Ultrapure ddNTP set (Pharmacia): 5-W solutions of ddATP, ddCTP, ddGTP, and ddTTP

3 Biotin- 16-dUTP, digoxigenin- 1 I-dUTP, and fluorescein- 12-dUTP (Boehringer, Mannheim, Germany)

4 Oligonucleotide primer (see Table 1) at 250 ng/pL

5 Tuq DNA polymerase (Boehringer) or AmpliTaq (Perkin Elmer, Chalfont St Giles, UK)

6 Klenow DNA polymerase (Boehringer)

7 Formamide (Fluka, Bornem, Belgium)

8 20X SSC: 3MNaC1, 300 m&I trisodium citrate, pH 7.0

Bright- Field Microscopic Detection 15 Table 1

Sequences of Oligonucleotide Primers Used in PRINS

Name Human origin Sequence

9 10X Taq buffer: 500 mMKC1, 100 mMTns-HCl, pH 8.3, 15 mMMgC12, 0.1% bovine serum albumin (BSA) (Sigma, St Louis, MO)

10 10X Klenow buffer: 500 mMTris-HCl, pH 7.2,lOO mMMgS04, 100 mMDTT, 1.5 mg/mL BSA

11 PRINS stop buffer: 500 mMNaC1,50 rnJ4 EDTA, pH 8 0

12 Washing buffer: 4X SSC (diluted from 20X SSC), 0.05% Triton X-100

13 Ethanol/37% HCl (100 1)-cleaned microscope slides and coverslips

2.2 ~fnzyme Cytochemicel Detection

1 Dried skimmed milk powder

2 Normal goat serum (NGS)

3 Horseradish peroxidase-conjugated avidin (AvPO) (Dako, Glostrup, Denmark)

4 Mouse antidigoxm (MADig) (Sigma)

5 Alkaline phosphatase-conjugated goat antimouse IgG (GAMAPase) (Dako)

6 Rabbit anti-FITC (RAFITC) (Dako)

7 Horseradish peroxidase-conjugated swine antirabbit IgG (SWARPO) (Dako)

8 Peroxidase (PO) inactivation solution: O.OlN HCI

9 30% H202 (Merck, Darmstadt, Germany)

10 Diaminobenzidine (DAB) (Sigma)

11 3,3’,5,5’-Tetramethylbenzidine (TMB) (Sigma)

12 Dioctyl sodium sulfosuccinate (DSSS) (Sigma)

13 Sodium tungstate (Sigma)

14 Naphthol-ASMX-phosphate (Sigma)

15 Fast red TR (Sigma)

16 Polyvinylalcohol (PVA), mol wt 40,000 (Sigma)

17 Nitro blue tetrazolium salt (NBT) (Boehrmger)

18 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) (Boehringer)

19 PO-DAB buffer: O.lM imidazole (Merck) in PBS, pH 7.6

76 Speel et al

20 PO-TMB buffer: 100 & citrate-phosphate buffer, pH 5.1

21 APase buffer: 0 2MTns-HCl, pH 8.5, 10 mMMgCl*, 5% PVA

22 Hematoxylin: Hematoxylin (Solution Gill no 3) (Slgma):distrlled water (1:4)

23 Immersion oil (Zeiss)

29 Bright-field microscope (Zeiss Axtophot)

30 Kodak Color Gold 100 ASA film

3 1 Blue and magenta filters

3 Methods

3.7 PRINS DNA Synthesis

1 Metaphase chromosomes are freshly prepared from peripheral blood lympho- cytes by standard methods, fixed in methanol:acetic acid (3:1), and spread on acid/alcohol cleaned slides (see Note 1)

2 Slides are passed through an alcohol series (70,90, and lOO%, 2 min each), which helps m preserving chromosome morphology, and air-dried

3 Chromosomal DNA 1s denatured m 70% formamide, 2X SSC, pH 7.0, for 2 mm

at 7O”C, followed by dehydration of the slides with 70% ethanol at 4”C, 90 and 100% ethanol, and an-drying

4 The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment Generally, 250 rig/slide m 40 pL IS used for primers of 16-30 bases complementary to repeated sequences

5 The PRMS reaction mix is made up on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 1: 10 with distilled water Dilute 100 mM dTTP 1: 100 Put together in a microcentrifuge tube: 1 u,L of each of the diluted dNTPs, 1 pL of either 1 nnl4 biotm- 16-dUTP, digoxigenin-1 1 -dUTP, or fluorescein- 12-dUTP (see Note 2), 5 $ of 10X Tuq buffer, 250 ng of oligonucleotide, 1 U Taq poly- merase, and distilled water to 50 $

6 Place 40 pL of this mixture under a coverslip on the slide, seal with rubber cement, an-dry the rubber cement, and transfer to the heating block of the thermal cycler

7 Each PRINS reaction cycle consists of 5 min at the appropriate annealing tem- perature (see Note 3) and 15 min at 72°C for in situ primer extension

8 Stop the PRINS reaction by transferring the slides (after removal of the rubber solution seal) to 50 mL of PRINS stop buffer in a Coplin jar at 65OC for 1 min

9 For sequential PRINS reactions, it was found essential to prevent free 3’-ends of the newly synthesized DNA from being used as primers for subsequent reactions This can be achieved by incubatmg the slides with Klenow DNA polymerase together with ddNTPs The reaction mix is made up as follows: Dilute 5 mM of all four ddNTPs 1: 10 with distilled water Put together in a microcentrifuge tube

Bright- Field Microscopic Detection 17 Table 2

Enzyme Cytochemical Detection

Systems That Can Be Used for PRINS-Labeled DNAa

Detection Label

Antimouse Ab-E Rabbit antimouse Ab-E

Biotin-labeled antimouse Ab Drgoxigenin-labeled antimouse Ab

aFurther amplification of PRINS signals may be achieved by combining these detection sys- tems with peroxrdase-mediated deposition of hapten- or fluorochrome-labeled tyramldes (1 I, 12)

bAbbreviations Ab, antibody; ABC, avidin biotmylated enzyme (horseradish peroxidase or alkaline phosphatase) complex; E, enzyme (horseradish peroxidase or alkaline phosphatase) CHapten = biotm, digoxtgenm, FITC, or DNP

dAntihapten antibody ratsed m another species (e.g., rabbit, goat, swine) can also be used as primary antibody in PIUNS detection schemes

2.5 @ of each of the ddNTPs, 5 pL of 10X Klenow buffer, 1 U Klenow DNA polymerase, and distilled water to 50 @,

10 Place 40 & of this mixture under a coverslip on the slide, transfer to a humid chamber, and incubate for 1 h at 37°C in an incubator

11 Dehydrate the slides as described in step 2 and au-dry before running the next PRINS reaction with another primer and different reporter

12 Finally, transfer the slides to washing buffer at room temperature and wash for 5 min

3.2 Enzyme Cytochemical Detection

1 Place 40 l,tL of blocking buffer under a coverslip on the slide and leave for 5 min

at room temperature to reduce background stammg in the detection procedures

2 Dilute detection molecules as follows: Dilute avidin conjugates m blocking buffer and antibody conjugates in PBS, 0.05% Tnton X-100,2% NGS

3 For single-target detection, incubate the slides for 30 mm at 37’C with the first detection layer (Table 2), and wash 2 x 5 min m the appropriate washmg buffer (4X SSC, 0.05% Triton X-100 for avidin, and PBS, 0.05% Triton X- 100 for anti- body molecules) Repeat this step with the next detection layer until all incuba- tions are complete

18 Speel et al

Table 3

Enzyme Cytochemical Reactions

That Can Be Used for In Situ Nucleic Acid Detectiona

Enzyme Enzyme reagents Embedding Absorption color Reference POb HZO, + DAB Aqueous/ Brown Graham and

1966 (13)

PO HZ02 + TMB Organic Green Speel et al.,

1994 (IO) APase N-ASMX-P + Aqueous Red Speel et al.,

PO, horseradish peroxldase, TMB, tetramethyl benzldme

4 After the last detection layer, wash samples with PBS for 5 min at room temperature

and visualize the DNA target by an appropriate enzyme reaction (see 5, and Table 3)

5 To detect multiple DNA targets labeled with different haptens, a combmatlon of enzyme cytochemlcal detection systems is chosen from Table 2 Smce the enzymes horseradish peroxidase (PO) and alkaline phosphatase (APase) can generate a number of differently colored precipitates (see Table 3), multiple DNA

targets can be visualized simultaneously by suitable combmattons of enzyme

reactions If the entire detection procedure uses more than one PO or APase reac- tion, the first applied enzyme can be inactivated after the first detection reaction

by incubating the sample in O.OlM HCl for 10 min at room temperature Then, the next detection system can be applied, followed by the appropriate enzyme reaction (Note 4)

6 As an example, a protocol for triple-target PRINS is outlined in Table 4 (Note 5) Protocols for bicolor detection of nucleic acid sequences in situ can be derived

from this protocol or can be found elsewhere (Note 6) (10,17-21)

7 Visualize the PRINS-labeled DNA targets with one of the following enzyme reactions (Note 7):

a PO-DAB reaction: Mix 1 mL 5 mg/mL DAB in PBS, 9 mL PO-DAB buffer, and 10 & 30% H202 just before use, and overlay each sample with 100 pL under a coverslip Incubate the slides for 5-15 min at 37’C, wash 3 x 5 min with PBS, dehydrate (optionally), and coverslip with an aqueous or organic mounting medium

b PO-TMB reaction: Dissolve 100 mg sodium tungstate m 7.5 mL PO-TMB buffer and adjust the pH of this solution to 5.0-5.5 with 37% HCl Just before

Bright-Field Microscopic Detection 19

Table 4

Enzyme Cytochemical Detectlon Protocol

for Three Nucleic Acid Sequences In Situ, Labeled with PRINS

Using Blotin-, Digoxigenin-, and FITC-Modified Nucleotides, Respectivelya

Visualize PO activity in brown (PO-DAB)

as described in Section 3.2., step 7a

Inactivate residual PO activity with

O.OliVHCl

Detect digoxigenm and FITC with

MADig/RAFITC (both diluted 1:2000)

Detect primary antibodies with

GAMAPase/SWARPO (diluted 1:25

and 1:lOO)

Visualize APase activity in red

(APase-fast red) as described in

Section 3 2., step 7c

Visualize PO activity in green

(PO-TMB) as described in Section 3.2.,

OFor details of detection systems, see Table 2

bAbbreviations used: APase, alkaline phosphatase; AvPO, PO-conjugated avidm; DAB, diaminobenzidine; GAMAPase, APase-conlugated goat antrmouse IgG; MADig, mouse antidigoxin; PO, horseradish peroxtdase; RAFITC, rabbit anti-FITC IgG, SWARPO, PO-conju- gated swine an&rabbit IgG

cFor details of the protein matrrx, see Section 3.2., step 9

use, dissolve 20 mg DSSS and 6 mg TMB in 2.5 mL 100% ethanol at 80°C Mix both solutions, add 10 pL HzOz, and overlay each sample with 100 pL under a coverslip Incubate the slides for l-2 min at 37Y!, wash 3 x 1 min with ice-cold 0 1Mphosphate buffer, pH 6.0, dehydrate (optionally), and cov- erslip with an organic mounting medium or immersion oil

c APase-fast red reaction: Mix 4 mL APase buffer, 1 mg naphthol-ASMX-phos- phate in 250 pL buffer without PVA, and 5 mg fast red TR m 750 Ccs, buffer without PVA just before use, and overlay each sample with 100 pL under a coverslip Incubate the slides for 5-15 min at 37”C, wash 3 x 5 min with PBS, and coverslip with an aqueous mounting medium (Note 8)

d Alkaline phosphatase-NBT/BCIP reaction: Dissolve 1.8 mg BCIP in 100 @., N,N-dimethylformamide and 3.3 mg NBT in 660 & distilled water and add

20 Speel et al

subsequently to 9.24 mL APase buffer Overlay each sample with 100 pL under

a coverslip Incubate the slides for 15-60 min at 37”C, wash 3 x S min with PBS, and coverslip with an aqueous mounting medium (Note 8)

8 Aher all enzyme reactions have been performed, counterstain the samples with hematoxylin, wash 1 x S min m tap water and 1 x 2 min in distilled water, and air-dry if you wish

9 Mount single-target PRINS samples in the embedding medium required for the used enzyme precipitate, as outlined in steps 7a-d and Table 3 Mount mul- tiple-target PRINS samples m the embedding medmm required for the used enzyme precipitates, unless they need different mounting In that case, apply a protein embedding layer by smearmg 50 pL of a mixture of 40 mg/mL BSA m distilled water and 4% formaldehyde onto the slides Air-dry for 10 min at 37°C (Note 9)

10 Examine slides under a bright-field microscope Microphotographs can be made usmg blue and magenta filters and Kodak 100 ASA film

3 The optimum primer annealing temperature is only determined empirically We usually try a series from 45 to 7O”C, in 5°C steps

4 Enzyme inactivation by an incubation with O.OlMHCl has no demonstrably nega- tive effect on the stability of the synthesized DNA and its incorporated reporters (blotin, digoxigenin, FITC)

5 If multiple enzyme reactions are utilized, the PO-TMB reaction must always be performed last, since the resulting precipitate proved to be unstable in aqueous solutions with a pH above 6.0 (e.g., distilled water and PBS)

6 In case of enzyme activity detection after application of a PO and APase conju- gate, the APase reaction must always be performed first to prevent inactivation

of APase during the PO reaction

7 It is recommended to follow every enzyme reaction under the microscope to ensure discrete localization of the in sztu signals

8 Do not dehydrate the slides after the APase reaction, since the precipitate dis- solves (partially) in organic solvents Optionally, you may air-dry the slides after rinsing in distilled water

9 Embedding in a protein layer is essential to prevent dissolving of the enzyme reaction product in an aqueous or organic mounting medium, or in immersion oil

In this way, it ensures stabilization of the enzyme precipitates and, in addition, optimal visualization of color contrast

Bright- Field Microscopic Detection 21 References

1 Bains, M A., Agarwal, R., Pringle, J H., Hutchinson, R M., and Lauder, I (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell sus- pensions by pnmer-induced in situ (PRINS) fluorescent nucleotide labeling Exp Ceil Res 208,321-326

2 Koch, J., Mogensen, J., Pedersen, S., Fischer, H., Hmdkjmr, S., Kolvraa, S., and Bolund, L (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labelmg with fluorescein-12-dUTP Cytogenet Cell Genet 60, l-3

3 Gosden, J and Lawson, D (1994) Rapid chromosome identificatron by oligo- nucleotide-primed in s~tu DNA synthesis (PRINS) Hum Mol Genet 3,93 l-936

4 Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J P (1995) PRINS

as a method for rapid chromosomal labeling of human spermatozoa Mel Reprod Dev 40,333-337

5 Speel, E J M., Lawson, D., Ramaekers, F C S., Gosden, J R., and Hopman, A

H N (1996) Raprd brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA m chromosome preparations and frozen tissue sections Bio- techniques 20,226234

6 Hindkjmr, J., Koch, J , Terkelsen, C., Brandt, C A., Kolvraa, S., and Bolund, L (1994) Fast, sensitive multicolor detection of nucleic acids in situ by primed in situ labeling (PRINS) Cytogenet Cell Genet 66, 152-154

7 Speel, E J M., Lawson, D., Hopman, A H N., and Gosden, J (1995) Multi- PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reac- tions label specific chromosomes and produce bands Hum Genet 95,2!3-33

8 Abbo, S., Dunford, R P., Miller, T E., Reader, S M., and King, I P (1993) Primer-mediated in s&u detection of the B-hordem gene cluster on barley chro- mosome 1H Proc Natl Acad Scz USA 90, 11,821-l 1,824

9 Volpi, E V and Baldini, A (1993) MultiPRINS a method for multicolor primed

m situ labeling Chromosome Res 1,257-260

10 Speel, E J M , Jansen, M P H M., Ramaekers, F C S., and Hopman, A H N (1994)

A novel triple-color detection procedure for brightfield microscopy, combinmg in situ hybridization with immunocytochemistry J Histochem Cytochem 42,1299-1307

11 Bobrow, M N., Harris, T D., Shaughnessy, K J., and Litt, G J (1989) Catalyzed reporter deposition, a novel method of signal amplification Amplrfication to immunoassays J Immunol Methods 125,279-285

12 Speel, E J M., Ramaekers, F C S., and Hopman, A H N (1995) Cytochemical detection systems form situ hybridization, and the combination wtth immunocy- tochemistry Histomchem J 27,833-858

13 Graham, R C and Karnovsky, M J (1966) The early stages of absorption of injected horseradish peroxidase in the proximal tissues of mouse kidney with struc- tural cytochemistry by a new technique J Histochem Cytochem 14,291-302

14 Speel, E J M., Schutte, B., Wiegant, J., Ramaekers, F C S., and Hopman, A H N (1992) A novel fluorescence detection method for m situ hybndtzation, based on the alkaline phosphatase-fast red reaction J Histochem Cytochem 40,1299-1308

17 Hopman, A H N., Wiegant, J., Raap, A K., Landegent, J E., Van der Ploeg, M., and Van Duijn, P (1986) B&color detection of two target DNAs by non-radioac- tive in situ hybridization Histochemistry 85, l-4

18 Emmerich, P., Loos, P., Jauch, A., Hopman, A H N., Wlegant, J., Higgins, M J., White, B N., Van der Ploeg, M., Cremer, C., and Cremer, T (1989) Double in situ hybridization in combination with digital image analysis: a new approach to study interphase chromosome topography Exp Cell Res 181, 126-140

19 Herrington, C S., Burns, J., Graham, A K., Bhatt, B., and McGee, J 0’ D (1989) Interphase cytogenetics using biotin and digoxygenin labeled probes II: simulta- neous differential detection of human and papilloma virus nucleic acids in indi- vidual nuclei J Clin Pathol 42,601-606

20 Mullink, H., Walboomers, J M M., Raap, A K., and Meyer, C J L M (1989) Two color DNA in situ hybridization for the detection of two viral genomes using non-radioactive probes Histochemrstry 91, 195-198

21 Kerstens, H M J., Poddighe, P J., and Hanselaar, A G J M (1994) Double- target m situ hybridization in brightfield microscopy J Histochem Cytochem 42, 1071-1077

Analysis of Sperm Aneuploidy by PRINS

Franck Pellestor and Jean-Paul Charlieu

1 Introduction

The estimation of aneuploidy rate in human gametes is a subject of interest and research because nondisjunctions make a major contribution to the chro- mosomal abnormalities found in humans Numerous questions remain concern- ing the occurrence and the etiology of such aneuploidy in gametes

Since human sperm is easier to obtain than mature human oocytes, most of the studies have focused on male gametes In the last decade, direct information on the chromosomal constitution of human sperm has been obtained thanks to the introduction of the in vitro human sperm-hamster egg fertilization system, which allows the karyotyping of human sperm complements (I,2) This new experimental system has provided a direct method to investigate several points (distribution of nondisjunction, sex ratio, paternal age effect, relationship to infertility) and to determinate the meiotic segregation of chromosomal rear- rangements (3,4) The method is time-consuming, labor-intensive, and of little profit in terms of sperm karyotypes obtained Recently, several laboratories have adapted the interphase fluorescence in situ hybridization (FISH) tech- nique to sperm in order to assess directly the incidence of disomy in human gametes (5,6) Aneuploidy has thus been estimated for several chromosomes usmg centromeric repeat probes However, the use of centromeric probes pre- sents some limitations because several human chromosomes share high levels

of homology in their a-satellite DNA sequences, resulting in crosshybridiza- tion in FISH reactions (7) The most striking example concerns chromosomes

13 and 21 for which this homology reaches 99.3% (8) In addition, the FISH analysis of spermatozoa is hampered by the fact that the DNA in sperm heads

is highly condensed and of difficult access

From: Methods fn Molecular Biology, Vol 71: PRINS and In Situ PCR Protocols

Edited by J R Gosden Humana Press Inc , Totowa, NJ

23

24 Pellestor and Charlieu The primed in situ (PRINS) technique provides an alternative approach for direct chromosomal detection, Because of the high complementarity between the oligonucleotide primer and its genomic target, PRINS appears to be more efficient than FISH for discriminating between a-satellite DNA sequences The limitation of the PRINS method for the analysis of nondisjunction in human sperm was initially that only one chromosome could be labeled Thus, the dis- tinction between diploidy and disomy could not be done by PRINS (9) The recent introduction of multicolor PRlNS protocols has allowed us to overcome this problem (10, II) We have adapted our protocol to human sperm The effi- ciency of the method has also been improved by the use of a new sperm pretreatment protocol that permits the simultaneous decondensation and dena- turation of sperm nuclei In PRINS, the decondensation of the sperm head is a less limiting factor than in FISH (where the probes are 200-500 bases long) because of the small size of the oligonucleotide primers (18-30 nucleotides) This facilitates their penetration into sperm nuclei and their access to the genomic sequences, resulting in a more homogeneous and more rapid labeling

of sperm nuclei (Fig 1)

2 Materials

2.7 Preparation of Sperm Samples

1 Phosphate-buffered saline (PBS) (Gibco BRL,, Eragny, France)

2 Methanol, 99% (Prolabo, Paris, France)

3 Ethanol, 99% (Prolabo)

4 Glacial acetic acid (Prolabo)

5 3MNaOH

6 Clean microscope glass slides

2.2 Dual-Color PRINS Reaction

1, 2’-Deoxyadenosine S-triphosphate (dATP) 100 mkf (Boehringer Mannheim,

Meylan, France)

2 2’-Deoxycytosine 5’-triphosphate (dCTP) 100 mM(Boehringer Mannheim)

3 2’-Deoxyguanosine 5’-triphosphate (dGTP) 100 n&f (Boehringer Mannheim)

4 2’-Deoxythymidine 5’-triphosphate (dTTP) 100 & (Boehringer Mannhelm)

5 Labeled dUTP (1 n&I): Biotin-16-dUTP (Boehringer Mannheim), digoxrgenin-

11 -dUTP (Boehringer Mannheim), fluorescein- 12-dUTP (Boehringer Mannheim), and tetramethylrhodamine-6-dUTP (Boehringer Mannheim)

6 2’.3’-Dideoxy-adenosine-5’kphosphate (ddATP) 10 mM (Boehringer Mannhelm)

7 2’.3’-Dideoxy-cytrdine-5’kphosphate (ddCTP) 10 mM(Boehringer Mannheim)

8 2’.3’-Dideoxy-guanosine-5’-triphosphate (ddGTP) 10 mA4 (Boehringer Mannheim)

9 2’.3’-Dideoxy-thymidine-5’-triphosphate (ddTTP) 10 mM(Boehrmger Mannheim)

10 Taq DNA polymerase (Boehringer Mannheim) (store at -20°C)

Il 10X Tuq buffer (Boehringer Mannheim) (store at -20°C)

Analysis of Sperm Aneuploidy 25

Fig 1 (see color plate number 3 after p 82) Examples of dual-color PRINS labeling

of human sperm nuclei (A,B) Normal haploid spermatozoa bearing distinctive green (chromosome 21) and red (chromosome 9) fluorescent spots (C) PRINS labeling of a disomic sperm nuclei for chromosome 18 The a satellite DNA of the chromosome 18 is labeled with biotin and detected with fluorescein-avidin-DCS The c1 satellite of the chromosome 12 is labeled with digoxigenin and detected with antidigoxigenin- rhodamine The arrow indicates a sperm nucleus showing two distinctive green fluores- cein spots (D) A diploid sperm (arrow) observed in a direct labeling PRJNS reaction performed with fluorescein-12-dUTP and rhodamine-6-dUTP for the detection of chro- mosomes 13 and 16, respectively The marked nucleus shows two green and two red fluorescent signals This nucleus is larger than normal haploid sperm nuclei

12 Glycerol, 87% (Prolabo)

13 Stop buffer: 500 mMNaC1,50 mMEDTA, pH 8.0 (store at 4’C)

14 20X SSC solution: 3MNaCl,0.3Mtrisodium citrate (store at 4°C)

15 Washing buffer: 4X SSC, pH 7.0,0.05% Tween-20 (Boehringer Mannheim)

16 Blocking buffer: Washing buffer plus 5% nonfat dry milk Make fresh each time

17 10X NT buffer: 500 mMTris-HCl, pH 7.2,50 mMMgS04, 0.1 mMdithiothreito1,

1 mg/mL BSA (store at 4’C)

18 Klenow enzyme (Boehringer Mannheim) (store at -2O’C)

19 Oligonucleotide primer at 50 pmol/$ (see Note 1 and Table 1)

20 Deionized, double-distilled water

2 1 Water bath at 72°C

26 Pellestor and Charlieu Table 1

The Characteristics of the Oligonucleotide Primers Used

Annealing Optimal Chromosome temperature, concentration, Name Locus location Sequences T PM 9c a sat 9 5’ TATCTGCAAGCG 51 150

22 Water bath at the annealing temperature

23 1.5~mL sterile microcentrifuge tubes

24 Coverslips (22 x 40 mm)

25 PCR machine fitted with a flat plate block Programs are given for the Techne PHC-3 and the Hybaid Omnigene

2.3 Detection

1 Fluorescein-Avidin-DCS (Vector Labs, Burlingame, CA)

2 Antidigoxigenin-rhodamine, Fab fragments (Boehringer Mannheim)

3 Anttfade solution Vectashteld (Vector Labs)

4 Propidium iodide (Sigma, St Louis, MO)

5 4’, 6-Diamidine-2-phenylindole dihydrochlroride (DAPI) (Boehringer Mannheim)

6 Staining jars

7 Microscope equipped with triple band pass filter (DAPI:FITC:rhodamine)

3 Methods

3.1 Preparation of Sperm Sample

1, Freshly ejaculated sperm sample is allowed to liquefy at room temperature for 30 min (see Note 2)

2 Dilute sperm 1:lO in PBS and centrifuge for 8 mm at 600g

3 Resuspend the pellet in 1 mL of fixative (3:1, methanol:glacial acettc acid)

4 Fix 1 h at -2O’C

5 Place in fresh fixative

6 Drop the cell suspension on a clean microscope slide from a height of about 5 cm

Analysis of Sperm Aneuploidy 27

7 The slide is air-dried and stored for l-5 d at room temperature before use for the PRINS reaction

8 Immediately before the PRLNS reaction, the slide is denatured in 3MNaOH at room temperature for 3-l 1 min depending on its age (see Note 3)

9 Pass slide through ethanol series (70,90, lOO%), 3 min each step, and air-dry

3.2 PRINS Reaction

3.2.1 First PRINS Reaction

1 Preparation of 10X dNTP mixtures: Dilute 100 mM dATP, dCTP, dGTP, and dTTP 1: 10 in drstilled water In a microcentrifnge tube, put 10 pL of each diluted dATP, dCTP, and dGTP Add 0.25 & of diluted dTTP, 25 pL of a l-n&f labeled dUTP, and 55 pL of glycerol 87% Well mix and store at -20°C

2 Make up the PRINS reaction mixture by mixing 200 pmol of the oligonucleotide primer, 5 pL 10X Tuq polymerase buffer, 5 pL 10X dNTP mixture (incorporat- ing biotin- 16-dUTP or fluorescein- 12-dUTP), and 2.5 U of Taq DNA polymerase

in a 1.5~nIL microcentrifuge tube Add sterile, double-distilled water to a final volume of 50 pL

3 Preheat the tube in a water bath at the annealing temperature

4 Place the prepared slide and a coverslip on the plate block of the PCR machine

5 Set program for the appropriate temperature The program consists of two steps:

a Twelve minutes at the annealing temperature, specific to the primer used (see Note 4 and Table 1) The slide and the coverslip are heated alone for 5 min to get them to the annealing temperature The PRTNS reaction mixture is then placed on the slide and covered with the coverslip The slide is incubated for

a further 7 min at the annealing temperature

b Thirty minutes at 72’C for nucleotide chain elongation At the beginning of this second step, the temperature is automatically raised to 72°C

6 Transfer the slide quickly to 100 mL of preheated stop buffer at 72°C for 3 min to terminate the PRINS reaction

3 Make up ddNTP reaction mixture by mixing 4 pL of 50 pA4ddNTP mixture, 4 pL of

1 OX NT buffer, 2 U of Klenow enzyme, and distilled water to a total of 40 pL,

4 Apply the ddNTP reaction mixture to the slide and incubate for 10 min at 37°C (or 30 min at room temperature) This intermediate reaction blocks the free 3’-ends of the first elongation fragment and so prevents mixing of labeling

5 Wash in stop buffer for 3 min at room temperature

6 Wash twice for 5 min in 1X NT buffer at room temperature

28 Pellestor and Char-lieu 3.2.3 Second PRl/VS Reaction

1 In 1 S-mL microcentrifugation tube, prepare the second PRINS reaction mixture, including a new primer specific for another chromosome and digoxlgemn- I 1 -dUTP

or rhodamine-6-dUTP (see Section 3.2.1.) step 2)

2 Prewarm this mixture at the annealing temperature specific for the new primer

3 Drain excess fluid, and place the slide again on the plate block of the PCR machine

4 Set program for the second PRINS reaction (see Section 3.2.1.) step 5)

5 Stop the reaction by immersing the slide in stop buffer at 72°C for 3 min

3.2.4 Detection

1 Wash the slide twice for 3 min at room temperature in 4X SSC, 0.05% Tween-20 with gentle agitation

2 Drain the slide and apply 100 pL of blockmg buffer

3 Incubate for 10 min at room temperature under a coverslip

4 Remove coverslip, drain excess fluid, and apply 100 pL of a 1: 1 mixture of avl- din DCS-FITC (5 @nL) and antidigoxigenin-rhodamine (20 pg/rnL) in block-

mg buffer to the slide Place on a new coverslip and incubate for 30 min at 37’C

7 Cover with a 22X 40-mm glass coverslip

8 Examine the slide under UV fluorescence equipped with triple band pass filter (Fig 1)

4 Notes

1 Primers are oligonucleotides, typically 18-30 bases long, specific for a-satellite DNA sequences of human chromosomes They are identified by comparing the a-satellite DNA sequence of each chromosome to the consensus a-satellite DNA sequence of human chromosomes established by Choo et al (12) The primer sequences are selected from the region with the most nucleotide divergences They are generated on an Applied Biosystem DNA synthesizer (model 38 1 A) according to the manufacturer’s instructions Their sequences and the technical conditions are given in Table 1 For convenience, primers are diluted to 50 pmol/& and stored at -2OY

2 The human semen sample is usually collected in a sterile container and is pro- cessed as soon as liquefaction has occurred A normal sperm sample should liq- uefy within 30 min of collection at room temperature The liquefaction may be hastened by incubating sperm samples at 37°C

3 The use of a 3M NaOH solution allows the simultaneous decondensation and denaturation of sperm nuclei, with the possibility of a rapid control of the degree

Analysis of Sperm Aneuploidy 29

of nuclear decondensation under the microscope The time of opttmal NaOH treatment depends on the age of the sperm preparation slides The longer the slides were aged, the longer they need 3MNaOH treatment: 2 d old, 4 min; 4 d old, 6 min; 6 d old, 8 min; 8 d old, 11 min Combined with PRINS, this method provides excellent results, i.e., homogeneous sperm decondensation and subse- quently a high level of sperm labeling

4 For each primer, the theoretical melting temperature is calculated, but optimal annealing temperatures must be determined empirically Usually, efficient annealing temperatures are in the -5 to +5’C range around the theoretical melt- ing temperature (Table 1)

1 Yanagimachi, R., Yanagimachi, H., and Rogers, B J (1976) The use of zona-free animal ova as a test system for the assessment of the fertilizing capacity of human spermatozoa Biol Reprod 15,471-476

2 Rudak, E., Jacobs, P A., and Yanagimachi, R (1978) Direct analysis of the chromosome constitution of human spermatozoa Nature 274,9 1 l-9 13

3 Martin, R H and Rademaker, A (1988) The relationship between sperm chro- mosomal abnormalities and sperm morphology in humans Mut Res 207,159-l 64

4 Pellestor, F., Sele, B., Jalbert, H., and Jalbert, P (1989) Direct segregation analy- sis of reciprocal translocations: a study of 283 sperm karyotypes from four carri- ers Am J Hum Genet 44,464-473

5 Guttenbach, M., Schakowski, R., and S&mid, M (1994) Incidence of chromo- some 3, 7, 10, 11, 17 and X disomy in mature sperm nuclei as determined by non-radioactive in situ hybridization Hum Genet 93,7-12

6 Bischoff, F Z., Nguyen, D D., Burt, K J., and Shaffer, L G (1994) Estimates of aneuploidy using multicolor fluorescence in situ hybridizatton on human sperm Cytogenet Cell Genet 66,237-243

7 Lebo, R V., Flandermeyer, R R., Diukman, R., Lynch, E D., Lepercq, J A., and Golbus, M S (1992) Prenatal diagnosis with repetitive m situ hybridization probes Am J Med Genet 43,848-854

8 Willard, H F and Waye, J S (1987) Hierarchical order in chromosome specific human alpha satellite DNA Trends Genet 3, 192-198

9 Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J P (1995) PRINS

as a method for rapid chromosomal labeling on human spermatozoa Mol Reprod Dev 40,333-337

10 Gosden, J, and Lawson, D (1994) Rapid chromosome identification by oligo- nucleotide-primed in situ DNA synthesis (PRMS) Hum Mol Genet 3,93 l-936

11 Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C! A., Kolvraa, S., and Bolund, L (1994) Fast, sensitive multicolor detection of nucleic acids in situ by primed in situ labeling (PRJNS) Cytogenet Cell Genet 66, 152-154

12 Choo, K H., Vissel, B., Nagy, A., Earle, E., and Kalitsis, P (1991) A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence Nucleic Acids Res 19,1179-l 182

PRINS DNA Synthesis

on Frozen Tissue Sections

Ernst J M Speel, Diane Lawson, Frans C S Ramaekers,

John R Gosden, and Anton H N Hopman

1 Introduction

Primed in situ (PRINS) labeling has become an alternative to in situ

hybridization (ISH) for the localization of nucleic acid sequences in cell prepa- rations (1-4) In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequence in situ The primer serves as an initiation site for in situ chain elonga- tion using a thermostable DNA polymerase and labeled nucleotides, which can

be detected directly by fluorescence microscopy, such as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxigenin-dUTP and the applica- tion of fluorochrome-conjugated avidin or antibody molecules (3,5,6) The detection limit of the PRINS technique appears to be in the order of low-copy sequences (3,7)

Here we describe an easy protocol for the application of the PRINS labeling reaction to frozen tissue sections (81 In this way, individual cells can be iden- tified in their tissue context and be analyzed for their copy numbers of specific chromosome regions Both tissue fixation and proteolytic digestion before performing the PRINS reaction proved to be the critical steps in the total pro- cedure permitting access of the PRINS reactants, while preserving the mor- phology of the nuclei in the tissue Such pretreatment steps have also been shown to be essential for efficient application of ISH to tissue sections (9, IO) Examples are shown of fluorescence and bright-field detection protocols for labeled DNA sequences m normal diploid tissue nuclei (Fig lC-E)

From Methods in Molecular Biology, Vol 71’ PRINS and In Situ PCR Protocols

EdlIed by J R Gosden Humana Press Inc., Totowa, NJ

31

Fig 1 (see color plate number 2 after p 82) (C) Bright-field detection of chromosome 9 centromeres with biotin/PO-TMB in a frozen tissue section of normal colon epithelium after PRINS, hematoxylin counterstaining, and immersion oil embedding (D) Bright- field detection of chromosome 9 centromeres with biotin/PO-DAB in a frozen tissue section of normal bladder epithelium after PRINS, hematoxylin counterstaining, and PBS/glycerol (1:9) embedding (E) Direct fluorescence detection of chromosome 9 centromeres with fluorored (red) in a frozen tissue section of normal bladder epithelium after PRINS and PBS/glycerol/DABCO embedding with DAPI counterstaining

2 Materials

2.1 PRINS DNA Labeling

1 Pepsin from porcine stomach mucosa (2500-3500 U/mg) (Sigma, St Louis, MO)

2 Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100~mM solutions of dATP, dCTP, dGTP, and dTTP

3 Biotin- 16-dUTP, digoxigenin- 11 -dUTP, fluorescein- 12-dUTP (Boehringer, Mannheim, Germany), fluorored-dUTP (Amersham, Little Chalfont, UK)

4 Oligonucleotide primers (see Table 1 of Chapter 3) at 250 ng/pL

5 Tag DNA polymerase (Boehringer) or AmpliTaq (Perkin Elmer, Chalfont St Giles, UK)

6 Bovine serum albumin (BSA) (Sigma)

7 20X SSC: 3MNaC1, 300 n-&I trisodium citrate, pH 7.0

PRINS DNA Synthesis 33

8 10X Tuq buffer: 500 mMKC1, 100 mMTris-HCl, pH 8.3,15 mMMgCl,, 0.1% BSA

9 PRINS stop buffer: 500 mMNaCl,50 mMEDTA, pH 8.0

10 Washing buffer: 4X SSC (diluted from 20X SSC), 0.05% Triton X- 100

11 Ethanol/37% HCl(100: I)-cleaned microscope slides and coverslips

12 Rubber cement

13 Water bath at 65*C

14 Thermal cycler (Hybaid Omnigene Flatbed) (Hybaid, Teddington, UK)

2.2 Cyfochefnicel Defection

1 Dried skimmed milk powder

2 Normal goat serum (NGS)

3 Horseradish peroxidase-conjugated avidin (AvPO) (Dako, Glostrup, Denmark)

4 Horseradish peroxidase-conjugated sheep antidigoxigenin Fab fragments (SHADigPO) (Boehringer)

5 30% HzOz (Merck, Darmstadt, Germany)

6 Diaminobenzidine (DAB) (Sigma)

7 3,3’,5,5’-Tetramethylbenzidine (TMB) (Sigma)

8 Dioctyl sodium sulfosuccinate (DSSS) (Sigma)

9 Sodium tungstate (Sigma)

10 Immersion oil (Zeiss)

11 Vectashield (Vector Brunschwig Chemie, Amsterdam, The Netherlands)

12 4’,6-Diamidino-2-phenyl indole (DAPI) (Sigma)

13 PO-DAB buffer: 0 1M imidazole (Merck) in PBS, pH 7.6

14 PO-TMB buffer: 100 m&f citrate-phosphate buffer, pH 5.1

15 Hematoxylin: Hematoxylin (Solution Gill no 3) (Sigma):dutrlled water (1:4)

16 Blocking buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, 5% skimmed milk powder

17 Washing buffer: 4X SSC, 0.05% Triton X-100

18 Incubator at 37“C

19 Zeiss Axiophot microscope (for fluorescence and bright-field microscopy)

20 Kodak 400 ASA and 100 ASA film

2 1 Blue and magenta filters

3 Methods

3.1 PRINS DNA Synthesis

1 Fresh tissue samples obtained after surgical resection are snap frozen in liquid nitrogen From each sample, cut 4-pm sections with a cryostat, mount them on poly+lysine-coated slides, and store at -20°C until use

2 Air-dry slides, fix in methanol:acetic acid (3:l) for 10 min at room temperature (see Note l), and air-dry again

3 Wash slides for 5 min in PBS and 2 min in O.OlMHCl

4 Treat samples with 100 pg/mL pepsin in O.OlMHCl for 10 min at 37’C, wash for

2 min in O.OlMHCl at 37OC, and pass the slides through an ethanol series starting with 70% ethanol in O.OlM HCl (Note 2)

4), 1 U Taq polymerase, and distilled water to 50 pL

7 Place 40 $ of this mixture under a coverslip on the slide, seal with rubber cement, air-dry the rubber cement, and transfer to the heating block of the ther- mal cycler

8 Each PRINS reaction cycle consists of 2 min at 94°C (for denaturation of cellular DNA, see Note 5), 5 min at the appropriate annealing temperature (see Note 6), and 15 mm at 72°C for zn situ primer extension

9 Stop the PRINS reaction by tran& -ing the slides (after removal of the rubber solution seal) to 50 mL of PRINS stL buffer in a Coplin jar at 65’C for 1 min

10 Transfer the slides to washing buffer at room temperature, and wash for 5 mm

3.2 Enzyme Cytochemical Detection

1 Place 40 & of blocking buffer under a coverslip on the slide, and leave for 5 min

at room temperature to reduce background staining in the detection procedures

2 Wash slides for 5 min in washing buffer

3 For reactions using biotin- 16-dUTP: Dilute AvPO 1: 100 in blocking buffer and apply 50 pL under a coverslip Incubate slides for 30 min at 37’C in a humid chamber (Note 7)

4 For reactions using digoxigenin- 11 -dUTP: Dilute SHADlgPO 1: 100 in blocking buffer and treat as in step 3 (Note 7)

5 Fluorescein-12-dUTP and fluorored-dUTP need no additional reporter and are simply mounted as described in step 11 (see Note 7)

6 Wash slides for 2 x 5 min in washing buffer and for 5 min tn PBS

7 Visuahze the PRINS-labeled DNA target by an appropriate horseradish peroxi- dase (PO) reactlon (I I; see also Chapter 3):

a Horseradish peroxldase-diaminobenzidine (PO-DAB) reaction: Mix 1 mL

5 mg/mL DAB in PBS, 9 mL PO-DAB buffer, and 10 $ 30% Hz02 just before use, and overlay each sample with 100 pL under a coverslip Incubate the slides for 5-15 min at 37”C, wash 3 x 5 min with PBS, and dehydrate optionally

b Horseradish peroxidase-tetramethylbenzidine (PO-TMB) reaction: Dissolve

100 mg sodium tungstate in 7.5 mL PO-TMB buffer, and adJust the pH of this solution to 5.0-5.5 with 37% HCl Just before use, dissolve 20 mg DSSS and

6 mg TMB in 2.5 mL 100% ethanol at 80°C Mix both solutions with 10 & H202, and overlay each sample with 100 J.& under a coverslip Incubate the slides for l-2 mm at 37”C, wash 3 x 1 min with ice-cold O.lM phosphate buffer (pH 6.0), and dehydrate

PRINS DNA Synthesis 35

8 After performing the enzyme reaction, counterstain the samples with hematoxy- lin, wash for 5 min in tap water and 2 mm in distilled water, and air-dry if you wish

9 Mount samples with the PO-DAB or PO-TMB precipitate in an organic mount- ing medium or immersion oil The PO-DAB precipitate can also be embedded in

an aqueous mounting medium Mount samples with fluorescent PRINS signals in Vectashield containing 0.5 pg/mL DAPI

10 Examine slides with absorption PRINS signals under a bright-field microscope Microphotographs can be made using blue and magenta filters and Kodak 100 ASA film Slides with fluorescent PRINS signals can be analyzed under a fluorescence microscope equipped with suitable filters Selected cells can be either directly pho- tographed using Kodak 400 ASA film, visualized with a charge-coupled device (CCD) camera, or scanned with a confocal scanning laser microscope (CSLM)

4 Notes

1 Fixation of frozen tissue sections with other fixatives, such as acetone (10 min at -2O’C), methanol (10 min at -2OY!), methanol/acetone (1 min at -2O”C/3 x 5 s room temperature), 70% ethanol (10 min at -2O’C), and 70% ethanol/l% formal- dehyde (10 min at -2O”C), resulted in poor preservation of cell morphology after PRINS In addition, we frequently observed fluorescent staining of the entire nucleus after PRINS labeling of methanol/acetone-fixed tissue sections, prob- ably caused by nuclease activities that survived methanol-acetone fixation (8)

2 Dehydration of the samples after pepsin treatment starting with 70% ethanol in O.OlMHCl helps in preserving cell morphology (manuscript in preparation)

3 In the case of labeling with biotin- 16-dUTP or fluorescein- 12-dUTP, a four times decrease of the concentration of dTTP in the PRINS reaction mix resulted in significant stronger labeling of DNA sequences Under the described standard conditions, digoxigenin-1 l-dUTP and fluorored-dUTP provide the highest sen- sitivity However, all the modified nucleotides are suitable for detection of repeated sequences in situ

4 The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment Generally, 250 rig/slide in 40 & is used for primers of 16-30 bases complementary to repeated sequences

5 Separate denaturation of cellular DNA in 70% formamide/2X SSC, pH 7.0, for 2 min at 70°C before the PRINS reaction, as is usually performed for chromosome preparations, resulted in no or only weak PRINS labeling of DNA sequences in situ Whether this is caused by inefficient primer annealing or extension is not clear at the moment The same phenomenon is also observed for PRINS on etha- nol-fixed cells (see Chapter 8)

6 The optimum primer annealing temperature is only determined empirically We usually try a series from 45 to 7O”C, in 5°C steps

7 Amplification of PRINS signals can be achieved as follows:

a AvPO detection of biotin-16-dUTP may be followed by incubation with biotinylated goat antiavidin (Vector), 1: 100 diluted in blocking buffer, and again AvPO

36 Speel et al

b SHADigPO detection of digoxigenin-1 l-dUTP may be substituted with incu- bation with monoclonal mouse antidigoxin (Sigma), PO-ConJugated rabbit antimouse IgG (Dako), and PO-conjugated swine antirabbrt IgG (Dako)

c FITC-12-dUTP signals may be amplified by incubation with monoclonal mouse anti-FITC (Dako) and FITC-conjugated rabbit antimouse IgG (Dako)

d Fluorored-dUTP signals cannot be amplified, since antirhodamin antibodies are not commercially available at this time

e Amplification of PRINS signals may also be achreved by combimng these detection systems with peroxidase-mediated deposition of hapten- or fluoro- chrome-labeled tyramides (12,13)

References

1 Bains, M A., Agarwal, R., Pringle, J H., Hutchmson, R M., and Lauder, I (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell sus- pensions by primer-induced in srtu (PRINS) fluorescent nucleotide labeling Exp Cell Res 208,321-326

2 Koch, J., Mogensen, J., Pedersen, S., Fischer, H., HindkJaer, S., Kiilvraa, S , and Bolund, L (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labeling with fluorescein-12-dUTP Cytogenet Cell Genet 60, l-3

3 Gosden, J and Lawson, D (1994) Rapid chromosome identification by oligo- nucleotide-primed in situ DNA synthesis (PRINS) Hum Mol Genet 3,93 l-936

4 Pellestor, F., Girardet, A., Lefort, G., Andrea, B., and Charheu, J P (1995) PRINS

as a method for rapid chromosomal labeling of human spermatozoa Mol Reprod Dev 40,333-337

5 Him&jar, J., Koch, J., Terkelsen, C., Brandt, C A., Karlvraa, S., and Bolund, L (1994) Fast, sensitive multicolor detection of nucleic acids in sn.u by primed m situ labeling (PRINS) Cytogenet Cell Genet 66, 152-l 54

6 Speel, E J M., Lawson, D., Hopman, A H N., and Gosden, J (1995) Multr- PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reac- tions label specific chromosomes and produce bands Hum Genet 95,29-33

7 Abbo, S., Dunford, R P., Miller, T E., Reader, S M., and King, I P (1993) Primer-mediated in situ detection of the B-hordein gene cluster on barley chro- mosome 1H Proc N&l Acud Sci USA 90, 11,821-l 1,824

8 Speel, E J M., Lawson, D., Ramaekers, F C S., Gosden, J R., and Hopman,

A H N (1996) Rapid brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA in chromosome preparations and frozen tissue sections Biotechniques 20,226-234

9 Hopman, A H N., Van Hooren, E., Van der Kaa, C A., Vooijs, G P., and Ramaekers, F C S (1991) Detection of numerical chromosome aberrations using

in situ hybridization in paraffin sections of routinely processed bladder cancers Mod Path01 4,503-513

10 Hopman, A H N., Poddighe, P J., Moesker, O., and Ramaekers, F C S (1992) Interphase cytogenetics: an approach to the detection of genetic aberrations m

PRINS DNA Synthesis 37

tumours, in Diagnostic Molecular Pathology, A Practical Approach, vol 1 (Herrington, C S and McGee, J O’.D., eds.), IRL, Oxford, pp 141-167

11 Speel, E J M., Jansen, M P H M., Ramaekers, F C S., and Hopman, A H N (1994) A novel trrple-color detection procedure for brightfield microscopy, com- bining in situ hybridization with immunocytochemrstry J Hzstochem Cytochem

42,1299-1307

12 Bobrow, M N., Harris, T D., Shaughnessy, K J., and Litt, G J (1989) Catalyzed reporter deposition, a novel method of signal amplification Amplification to immunoassays J Immunol Methods 125,279-285

13 Speel, E J M., Ramaekers, F C S., and Hopman, A H N (1995) Cytochemrcal detection systems for in situ hybridrzation, and the combmatron with immunocy- tochemistry Histochem J 27,833-858

Multiple Sequential Oligonucleotide

Primed /n Sctu DNA Syntheses (MULTI-PRINS)

John R Gosden and Diane Lawson

1 Introduction

Conventional PRINS (if it is possible to use such a description for a relatively new technique) is capable of identifying and quantifying chromosomes or chro- mosome pairs in metaphase or interphase cells (1-4) Each PRINS reaction can only identify one pair of homologous chromosomes, because the nature of the reaction means that the product of only one primer or primer pair can be spe- cifically labeled in each reaction However, by inserting a blocking step after each PRINS reaction to ensure that the 3’-ends of the products of the previous reaction cannot act as primers for the next reaction, it is possible to perform several PRINS reactions on a single slide, and therefore ascertain the number

of each of several pairs of chromosomes present in a given sample

2 Materials

2.1 PRINS Synthesis

1 Twin-Frost glass slides and 22 x 40 mm covershps The slides must be cleaned

by soaking m ethanol, to which a few drops of HCI have been added, followed by polishing with a clean piece of muslin before the cells are deposited on the slide

Coverslips must be cleaned in the same way before use

2 PRINS buffer (10X): 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 15 m/L4 MgCl,, 0.1% BSA

3 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia Biotech, St Albans, UK), diluted 1: 10 with sterile distilled H20

4 2’-Deoxycytidine 5’-triphosphate (dCTP): lOO-rmI4solution (Pharmacia Biotech), diluted 1: 10 with sterile distilled H,O

5 2’-Deoxyguanosine 5’-triphosphate (dGTP): 100-M solution (Pharrnacia Biotech), diluted 1.10 with sterile distilled H,O

From Methods m Molecular Biology, Vol 71’ PRM and In Situ PCR Protocols

Edlted by J FL Gosden Humana Press lnc , Totowa, NJ

39

40 Gosden and Lawson

TGGGCTGGAATGGAAAGGAATCGAAAC TCCATTCGATTCCATTTTTTTCGAGAA

ATAATTTCCCATAACTAAACACA TGTGAAGATAAAGGAAAAGGCTT

6 2’-Deoxythymidine 5’-triphosphate (dTTP): 100-d solution (Pharmacia Biotech), diluted 1: 100 with sterile distilled H,O

7 Biotin- 16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mann- heim, Germany)

8 Digoxigenin-I 1- deoxyuridine-5’-triphosphate (Dig- 1 l-dUTP) (Boehringer Mannheim)

9 FluoroRed (Amersham International, plc., Buckinghamshire, England)

10 FluoroGreen (Amersham International, plc.)

11 FluoroBlue (Amersham International, plc.)

12 Oligonucleotide primer(s) at 250 ng/mL See Note 1 Examples of primers are shown in Table 1, and results wrth these primers in Fig 1

13 Tug DNA polymerase (Tuq [Boehringer], AmpliTuq [Perkm Elmer, Foster Crty, CA] or ThermoprimerlUs [Advanced Biotechnologies Ltd., Leatherhead, England])

14 Rubber cement (vulcanizing solution) (e.g , Tip-Top, Stahlgruber, DS-8011 Pomg, Germany) (see Note 2)

15 Stop buffer: 500 mM NaCl, 50 mA4 EDTA

16 Flat-bed thermal cycler (see Note 3)

17 Water bath at 65OC

2.2 Blocking

1 0.025 mA4 2’,3’ dideoxyadenosine 5’-triphosphate (ddATP) (Pharmacia)

2 0.025 mM2’,3’ dideoxycytidine 5’-triphosphate (ddCTP) (Pharmacia)

3 0.025 mM2’,3’ dideoxyguanosine 5’-triphosphate (ddGTP) (Pharmacta)

4 0.025 mA4 2’,3’ dideoxythymtdine 5’-triphosphate (ddTTP) (Pharmacia)

5 DNA polymerase 1, large fragment (Klenow enzyme) (Boehringer Mannheim)

6 10X Nick translation buffer (10X NT): OSM Tris-HCl, pH 7.2, O.lM MgS04, 0.1 n&f dtthiothreitol, 1.5 mg/mL BSA

2.3 Defection

1 Dried skimmed milk powder

2 Avidin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlingame, CA)

3 Avidm-DCS-Texas red (Av-TR) (Vector Labs)

4 Antidtgoxigenin-fluorescein (anti-DIG-FITC) (Boehringer Mannheim)

5 Antidigoxigenin-rhodamine (anti-DIG-rhodamine) (Boehringer Mannheim)