... about prison education and training Apart from in Norway and Sweden, little evaluation and research has been done into prison education and training At the same time, quality assurance is a general ... purpose-oriented and relevant Preparatory Adult Education The Act on Preparatory Adult Education (Act no 487 from 31 May 2000) gave the Prisons and Probation Service a special status in...
Ngày tải lên: 15/03/2014, 10:20
... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 31 PTI1-4, a common target of OXI1 and MAPKs C Forzani et al AGC2-3) were also...
Ngày tải lên: 14/02/2014, 19:20
Community-Based Health Education Intervention: A Service-Learning Approach docx
... findings at the collegewide research symposium, and sometimes they also present papers at the national conference such as American Association of Health, Physical Education, Recreation, and Dance (AAHPERD) ... health education programs and evaluating such programs after they have ended are important, health agencies lack enough professionals that are prepared to these tasks; therefore...
Ngày tải lên: 22/03/2014, 15:21
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf
... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... previously [11] To replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -3...
Ngày tải lên: 24/03/2014, 04:21
Giáo án tiếng anh lớp 10: Unit 13: Films and Cinema Period 81: I. Objectives: 1. Education Aims: a ppt
... America It is based on the true story of Titanic 6 The main character are Jack Dawson and Rose DeWitt Bukater Jack is a young and generous adventurer Jack and Rose fall in love with each other ... Titanic in task - Ask some Ss to read these and to answer the words again questions about the film - Ask Ss to read the description - Work in pairs to ask of the film Titanic in task and...
Ngày tải lên: 27/07/2014, 19:21
The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function
... ClassII: ARF4 , ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases Ran Sar Sar 1a, Sar1b Fig A schematic ... human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5 human Arl5 human Arl8 human Arl8 human Arl4 human Arl4...
Ngày tải lên: 17/09/2015, 17:20
Learning english is a piece of cake 1
... think English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece ... In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid...
Ngày tải lên: 27/01/2014, 20:11
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... 5¢ splice donor (nt) 3¢ splice acceptor 1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag ... Journal compilation ª 2009 FEBS 4277 Transcription factor SAF-3 is expressed during inflammation A Ray et al Fig Analysis of a structurally altered form of SAF The nucleic ac...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
... Functional association of Ki-1 ⁄ 57 and PRMT1 D O Passos et al Preparation of cytoplasmic and nuclear extracts, methylation assays with cellular Ki-1 ⁄ 57 and metabolic labeling Carlos H I Ramos and ... 57 interacts with RACK1 and is a substrate for the phosphorylation by phorbol 12-myristate 13-acetate activated protein kinase C J Biol Chem 279, 11444–11455 12 Oza...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx
... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... SDF-1-unstimulated and stimulated HeLa cells were treated with a 1941 Syndecan-4 is an auxiliary receptor for SDF-1 /CXCL12 N Charnaux et al A C B Fig Heparan sulfate is invo...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... pcDNA3.1-GST -Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CG...
Ngày tải lên: 23/03/2014, 07:20