Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

SAF-3 mRNA, isolated from a cDNA library produced from IL-1b-induced cells, originates from a previ-ously unknown first coding exon, and thereby contains a unique N-termi-nal domain but s

family, is expressed during inflammation

Alpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2and Bimal K Ray1

1 Department of Veterinary Pathobiology, University of Missouri, Columbia, MO, USA

2 Department of Pathology, School of Medicine, Keio University, Tokyo, Japan

Introduction

Transcription factors play a central role in regulating

cell growth and development as well as in cellular

maintenance as a result of their indispensable role in

synthesizing mRNA Dysregulation of transcription

factor activity leads to alteration in target gene

expres-sion patterns, which is one of the most important

causes of disease development and progression

Exten-sive studies on the characterization of transcription factors have indicated that, in general, transcription factors exist as a family of structurally related proteins, containing conserved and unique domains The family members can perform similar tasks due to the con-served domains but may be functionally specific due to the unique domains The various members of the

Keywords

gene expression; inflammation; SAF-1/MAZ/

Pur-1; splice variant; transcription factor

Correspondence

B K Ray, Department of Veterinary

Pathobiology, University of Missouri, 124

Connaway Hall, Columbia, MO 65211, USA

Fax: +1 573 884 5414

Tel: +1 573 882 4461

E-mail: rayb@missouri.edu

A Ray, Department of Veterinary

Pathobiology, University of Missouri, 126

Connaway Hall, Columbia, MO 65211, USA

Fax: +1 573 884 5414

Tel: +1 573 882 6728

E-mail: rayal@missouri.edu

Database

The sequence for MAZ genomic DNA has

been submitted to the Genbank database

under the accession numbers D89880.

(Received 6 January 2009, revised 12 May

2009, accepted 5 June 2009)

doi:10.1111/j.1742-4658.2009.07136.x

The Cys2His2-type zinc finger transcription factor serum amyloid A activa-ting factor 1 [SAF-1, also known as MAZ (myc-associated zinc finger protein) or Pur-1 (purine binding factor-1)] plays an important role in regu-lation of a variety of inflammation-responsive genes An SAF-2 splice vari-ant acting as a negative regulator of SAF-1 was identified previously, and the present study reports the identification of a novel SAF-3 splice variant that is expressed during inflammation SAF-3 mRNA, isolated from a cDNA library produced from IL-1b-induced cells, originates from a previ-ously unknown first coding exon, and thereby contains a unique N-termi-nal domain but shares the same six zinc finger DNA-binding domains as present in SAF-1 In addition, a negatively functioning domain present at the N-terminus of SAF-1 and SAF-2 is spliced out in SAF-3 The expres-sion of SAF-3 is very low in normal tissues and in cells grown under normal conditions However, RT-PCR analysis of mRNAs from cytokine and growth factor-induced cells as well of mRNAs isolated from several diseased tissues revealed abundant expression of SAF-3 The transactiva-tion potential of SAF-3 is much greater than that of the predominantly expressed splice variant SAF-1 These findings show that transcriptional regulation of downstream inflammation-responsive genes by SAF/MAZ/ Pur-1 is likely to be more complex than previously assumed In addition,

we show that SAF-3 expression initiates from an upstream novel promoter This is the first report of the existence of multiple promoters regulating expression of the SAF/MAZ/Pur-1 family of proteins

Abbreviations

CAT, chloramphenicol acetyl transferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MAZ, myc-associated zinc finger protein; MMP, matrix metalloproteinase; OA, osteoarthritis; Pur-1, purine binding factor-1; RA, rheumatoid arthritis; SAF-1, serum amyloid A activating factor; VEGF, vascular endothelial growth factor.

family are often generated from a single gene by

alter-native splicing, which is recognized as an efficient

means of increasing the diversity of proteins

Serum amyloid A activating factor 1 (SAF-1) is the

first identified member of a transcription factor family

containing multiple Cys2His2-type zinc finger proteins

[1] The human and mouse orthologs of SAF-1 are

known as myc-associated zinc finger protein (MAZ) [2]

and purine binding factor-1 (Pur-1) [3], respectively

The SAF-1/MAZ/Pur-1 transcription factor is an

inflammation-responsive protein, and regulates the

expression of a variety of genes that include serum

amyloid A [1,4], vascular endothelial growth factor

(VEGF) [5], p21 [6], several matrix metalloproteinases

(MMPs) [7–10], c-myc [2], insulin [3], and the serotonin

1A receptor [11], which are involved in diverse cellular

processes and various pathogenic conditions A

num-ber of inflammatory stimuli such as cytokines [12],

phorbol 12-myristate 13-acetate [13],

lipopolysaccha-ride [14] and oxidized low-density lipoproteins [15]

have been shown to activate SAF-1 protein and

increase its DNA-binding and transactivating

func-tions The SAF-1 DNA-binding and transcriptional

activity is significantly increased in response to

media-tors of signal transduction and phosphorylation by a

number of protein kinases [13,16,17] The transcript

level of SAF-1/MAZ is also reported to be increased

in response to cytokine stimulation [18], in

hepatocel-lular carcinoma [19], chronic myelogenous leukemia

[20] and acute myeloid leukemia [21], and during

skele-tal myocyte differentiation [22]

In a previous analysis, we identified SAF-2 [23], the

second member of this family, which is encoded by the

same gene by alternate splicing Insertion of a new

exon originating from the non-coding sequences of

intron 4 of the SAF-1/MAZ gene resulted in creation

of a different C-terminus consisting of eight zinc finger

domains in SAF-2 [23] The SAF-2 isoform has a

much higher DNA-binding activity and acts as a

nega-tive regulator of SAF-1 function under normal

condi-tions [23] During inflammation, SAF-2 expression is

down-regulated, which alleviates the repression of

SAF-1 activity and further promotes SAF-1-mediated

transactivation of the target genes [23] In this paper,

we present evidence for a third member of SAF family,

which is also transcribed from the same gene but

origi-nates from an upstream novel start site and contains

an entirely different N-terminus Expression of SAF-3

is restricted to inflammatory conditions Further, we

present evidence that SAF-3 is much more

transcrip-tionally active than SAF-1 These results shed light on

the relevance of the generation of multiple distinct

functional SAF isoforms, and imply the existence of

combinatorial mechanisms that allow fine regulation

by SAF-regulated genes

Results

Identification and characterization of a novel SAF isoform

Screening of an IL-1b-induced human HTB-94 chon-drocyte cell cDNA library identified a novel human SAF-1/MAZ/Pur-1 isoform that contains unique N-terminal sequences (Fig 1) This clone, with an open reading frame of 455 amino acids, was designated SAF-3 (GenBank accession number FJ532357), with SAF-1/MAZ/Pur-1 being the originally identified iso-form [1–3] Comparison of amino acid sequences indi-cated that the N-terminal region of SAF-3 is different from that of SAF-1, after which both cDNAs contain identical sequences The previously isolated SAF-2 iso-form differs from SAF-3 at both the N- and C-termini [23] SAF-1 and SAF-2 have identical N-termini, but the SAF-2 mRNA contains an unique exon near the 3¢ end, and thus its C-terminus is different from that of SAF-1 [23] The open reading frames in SAF-1, SAF-2 and SAF-3 code for 477, 493 and 455 amino acids, respectively

SAF-3 is produced by alternative splicing

To determine the presence of unique N-terminal domain in SAF-3, we examined the genomic DNA sequence of human SAF-1/MAZ/Pur-1 [24] Sequence analysis indicated that the unique N-terminal amino acids of SAF-3 are encoded by a previously unidenti-fied exon (exon 1A) that is present 351 nucleotides upstream of the first exon of human SAF-1/MAZ (Fig 2A) The first exon in human SAF-3 (exon 1A) encodes 12 amino acids, including the initiator methio-nine (Fig 2B) The nucleotide sequence around the ini-tiation ATG codon in SAF-3 matches the translation initiation site consensus sequence as determined by Kozak [25] (Fig 2B) The second exon of SAF-3 (exon 1C) starts at around the middle of the first exon of SAF-1/SAF-2 The SAF-3 transcript also represents an in-frame splicing event, for which the open reading frame remains unchanged The 5¢ and 3¢ splice junc-tions of exons 1A and 1C match consensus splice donor and acceptor sequences (Fig 2C and Table 1) The N-terminal amino acid sequences of three SAF isoforms are shown in Fig 2D We performed primer extension analysis to determine whether the SAF-3 cDNA contains a full-length 5¢ UTR A 32 P-end-labeled, 18-base antisense oligonucleotide primer was

Fig 1 Analysis of a structurally altered form of SAF The nucleic acid and predicted amino acid sequences of the cDNA encod-ing SAF-3 are shown The initiator ATG codon and stop codon are indicated.

utilized for the primer extension reaction, and indicated several possible transcription start sites for SAF-3 mRNA (Fig 2E, lane 2) However, the esti-mated length of the major primer extension product corresponded well with the sequence of cloned SAF-3, suggesting that this cDNA possibly contains a full-length 5¢ UTR The two faint but longer primer-extended products that were visible in Fig 2E, lane 2, probably arise from other transcription start sites, and are minor transcription products Nested RT-PCR analysis was performed for further verification of the existence of novel exon 1A in SAF-3 A product of the

A

B

E

F

G

H C

D

Fig 2 Schematic representations of SAF splice variants (A) Exons are indicated by white boxes, and 5¢ and 3¢ UTRs by speckled boxes The introns and UTRs are not drawn to scale The positions of the primers used for RT-PCR are indicated by bold lines (B) Sequence of exon 1A in SAF-3 The Kozak consensus sequence is indicated by a line above the sequence (C) The exon/intron boundaries conform to consensus splice junction sequences (D) N-terminal amino acids of the SAF-1/SAF-2 and SAF-3 isoforms (E) Primer extension analysis A 5¢ end-labeled oligonucleotide complementary to a sequence near the 5¢ end of sequenced cDNA (+4 to +21 with respect to translation initiator ATG codon) was used to prime cDNA synthesis using poly(A) + RNA from IL-1b-induced HTB-94 cells (lane 2) The arrow indicates the major primer extension product, and the arrowheads show minor primer extension products As a negative control, yeast tRNA was used in sepa-rate extension reaction, and no extension product was produced (lane 3) Lane 1 contains a G-specific reaction of an unrelated sequence that was used as a size marker to determine the length of the primer extension products (F) RT-PCR analysis Total RNA isolated from IL-1b-induced HTB-94 cells was subjected to reverse transcription and nested PCR using SAF-3-specific (lane 1) and SAF-1-specific (lane 2) oligo-nucleotide primers The amplified product was verified by direct DNA sequencing (G) Bacterially expressed SAF-1 (lane 2) and SAF-3 (lane 3) proteins were fractionated by SDS–PAGE The migration positions of these proteins in lanes 2 and 3 are indicated Lane 1 contains pro-teins from vector-transfected cells (H) In vitro transcription and translation A linear plasmid containing full-length SAF-3 cDNA downstream

of T7 RNA polymerase transcription start sequences was subjected to in vitro transcription and translation The protein products were labeled with 35 S-methionine, fractionated by SDS–PAGE and autoradiographed Lane 1 contains no added DNA and lane 2 contains SAF-3 plasmid DNA The sizes of the protein products were identified using standard protein molecular weight markers.

Table 1 Sequences of exon/intron junctions in human SAF-3 Exon

sequences are shown in upper-case letters, and intron sequences

are shown in lower-case letters.

Exon

Exon

size

(nt) 5¢ splice donor

Intron size (nt) 3¢ splice acceptor

1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC

1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG

2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA

3 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG

4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG

5 1028

right size was amplified from mRNAs of

IL-1b-induced HTB-94 cells using an upstream primer

corre-sponding to the 5¢ untranslated sequences of SAF-3

and a downstream primer corresponding to the

sequences at exon 2 (Fig 2F, lane 1) The identity of

the PCR-amplified product was verified by DNA

sequence analysis The same downstream primer at

exon 2, together with an upstream primer

correspond-ing to the SAF-1 sequence at exon 1B, produced an

SAF-1-specific PCR product (Fig 2F, lane 2) The

translation product of SAF-3 cDNA was determined

by cloning SAF-3 cDNA in a bacterial expression

vec-tor (Fig 2G) In line with the cDNA size, bacterially

expressed SAF-3 protein migrates slightly faster than

bacterially expressed SAF-1 protein in the same vector

(Fig 2G, compare lanes 3 and 2) We performed a

coupled in vitro transcription and translation reaction

to further determine whether SAF-3 is indeed initiated

from the first ATG codon The SAF-3 protein

trans-lated from the predicted ATG codon is 455 amino

acids long The next ATG codon in the SAF-3 cDNA

is 603 nucleotides downstream of the first ATG codon,

and a protein initiated from this ATG would be of

considerable smaller size, containing 254 amino acids

and with an approximate molecular mass of 28 kDa

As seen in Fig 2H, lane 3, the in vitro transcribed and

translated protein product from SAF-3 cDNA was of

similar size to that obtained using the bacterial expression system, indicating that the major translation product of SAF-3 mRNA is 455 amino acids long

Inflammation-responsive expression of SAF-3

To determine the expression pattern of SAF-3, we hybridized a multiple-tissue Northern blot with a radiolabeled SAF-3-specific oligonucleotide probe (cor-responding to exon 1A), and found no detectable signal (Fig 3A) However, upon re-hybridization with

a full-length SAF-1 cDNA probe containing sequences common to SAF-1, SAF-2 and SAF-3, the same blot showed the presence of multiple bands (Fig 3B) As a positive control for the SAF-3-specific oligonucleotide probe, we prepared SAF-1 and SAF-3 RNA by in vitro transcription and hybridized the RNA with radioactive SAF-3 oligonucleotide probe This probe clearly detected in vitro transcribed SAF-3 mRNA but did not detect SAF-1 mRNA (Fig 3C) Together, these results suggest very low SAF-3 expression in normal tissues Given that SAF-3 was isolated from a cDNA library produced from IL-1b-induced cells, we examined the status of this isoform during cytokine stimulation of cells RT-PCR of RNA isolated from untreated and IL-1b-treated HTB-94 cells showed expression of a detectable level of SAF-3 only upon cytokine induction

E

Fig 3 Cytokine or growth factor treatment stimulates expression of SAF-3 (A) Northern analysis of an RNA blot (Clontech) containing 1.0 lg

of poly(A) + RNA per lane from various tissues as indicated The blot was hybridized using a 32 P-labeled oligonucleotide probe containing unique exon 1A sequences of SAF-3 mRNA (B) The same blot was stripped and re-hybridized with a full-length 1.4 kb 32 P-labeled SAF-1 cDNA probe (C) SAF-1 (lane 2) and SAF-3 (lane 3) RNAs were in vitro transcribed from corresponding cDNA plasmids by T7 RNA polymerase Reaction products were fractionated in a 1% agarose gel, transferred to nylon membrane, and hybridized with a 32 P-labeled oligonucleotide probe containing unique exon 1A sequences of SAF-3 mRNA Lane 1 contains HindIII-digested kcI857 DNA (D) HTB-94 and Saos-2 cells were treated with or without IL-1b (500 UÆmL)1) or TGFb (5 ngÆmL)1), as indicated Total RNA isolated from these cells was subjected to reverse transcription followed by nested PCR amplification to monitor SAF-3 expression The same sets of RNAs were also used to monitor MMP-9 and GAPDH expression, as indicated The PCR products were separated in a 1.5% agarose gel and visualized by ethidium bromide staining (E) Western blotting with SAF-3-specific antibody One microgram each of purified bacterially expressed SAF-1 protein (lane 1) and SAF-3 protein (lane 2) and 50.0 lg each of uninduced (lane 3) and IL-1b-induced (lane 4) HTB-94 cell extracts were fractionated by 11% SDS– PAGE, transferred onto membrane and Western blotted with anti-SAF-3 serum The arrow indicates SAF-3 protein in IL-1b-induced cells.

(Fig 3D, lanes 1 and 2) SAF-3 was also detected in

TGFb-induced Saos-2 osteosarcoma cells (Fig 3D,

lanes 3 and 4) As positive control, we examined the

expression of MMP-9, which is known to be induced

in HTB-94 cells by both IL-1b and TGFb MMP-9

expression was detected in both IL-1b- and

TGFb-stimulated cells As a control for the same input of

RNA in RT-PCR, the glyceraldehyde-3-phosphate

dehydrogenase (GADPH) expression pattern was

mon-itored, and this remained unchanged during cytokine

induction To detect in vivo expression of SAF-3, a

spe-cific antibody was generated utilizing the unique

N-ter-minal peptide sequences Western blot analysis was

performed to confirm the specificity of this antibody, as

it did not detect bacterially expressed SAF-1 protein

but clearly detected bacterially expressed SAF-3 protein

(Fig 3E, lanes 1 and 2) SAF-3 expression was detected

at a low level in IL-1b-induced HTB-94 cells using this

antibody (Fig 3E, lanes 3 and 4)

Detection of SAF-3 mRNA in chronic

inflammatory diseased tissues

Given the cytokine-responsive expression of SAF-3, we

examined its level in diseased tissues Osteoarthritis

(OA) is a chronic inflammatory disease that involves

degeneration of the cartilage tissue, while rheumatoid

arthritis (RA) is a systematic chronic inflammatory

and destructive arthropathy As seen in Fig 4, SAF-3

mRNA expression was detected in OA synovial

(Fig 4, lanes 3–6) and RA synovial (Fig 4, lanes 7–9)

tissues, but very little to no SAF-3 mRNA expression

was detected in normal synovium (Fig 4, lanes 1 and

2) SAF-1 expression was detected in normal tissues

and was slightly elevated in both disease conditions

This result is consistent with previous findings

indicat-ing that the main mode of activation of SAF-1 is by

post-translational modification, including

phosphoryla-tion [13, 16, 17] Together, these results indicated that SAF-3 expression is very low and highly regulated under normal conditions, but increases in response to pathogenic signals and cytokine or growth factor stimulation

SAF-3 is a superior transcriptional activator SAF-3 contains six zinc finger motifs, and should have the ability to interact with DNA at a similar level to SAF-1 [26] However, because it contains a different N-terminus, the transactivation potential of SAF-3 may be different, and it may thereby regulate expres-sion of downstream genes at a different level To determine the functional significance of SAF-3, we compared its transactivation potential with that of SAF-1 The SAF-3 expression plasmid transactivated expression of the SAF-3X-CAT reporter at a much higher level than the same amount of SAF-1 expression plasmid DNA (Fig 5A) To rule out the possibility that SAF-1 and SAF-3 proteins were not expressed at the same level, we performed a Western blot assay using an anti-His tag IgG and representative trans-fected cells (Fig 5B) This experiment showed no discrepancy in the expression of proteins, indicating that SAF-3 is a superior transcriptional activator compared to SAF-1 For further verification, we compared ability of these two isoforms to transactivate expression of VEGF, a natural SAF-regulated gene [5]

In correlation with previous results, the SAF-3 expression plasmid increased expression of the 1.2 VEGF-CAT reporter in a more effective manner (Fig 5C) Together, these results show that the SAF-3 splice variant has significantly higher transactivation potential

SAF-3 mRNA is transcribed from a distinct transcription start site

An SAF-1/SAF-2-specific 5¢ RACE did not reveal any upstream 5¢ sequences in SAF-3 (data not shown); this suggests that SAF-3 and SAF-1/SAF-2 mRNAs may

be transcribed from distinct promoter regions To determine whether SAF-3 and SAF-1/SAF-2 mRNAs are initiated from different promoters, we examined the respective 5¢ flanking regions Genomic DNA sequences upstream of SAF-3 and SAF-1/SAF-2 were ligated into the promoterless vector pBLCAT3 to produce ()2000/+200)SAF-CAT, ()2000/)351)SAF-CAT and ()351/+200)SAF-()2000/)351)SAF-CAT reporter constructs Transient transfection of HTB-94 cells with these reporters resulted in significantly higher levels of chloramphenicol acetyl transferase (CAT) activity,

Fig 4 SAF-3 expression is detected in human arthritic tissues.

Total RNA was isolated from representative normal, OA and RA

synovium tissues and subjected to RT-PCR using SAF-3-,

SAF-1-and GAPDH-specific primers, as indicated GAPDH expression was

used as an internal control.

albeit variable, compared to cells transfected with the promoterless pBLCAT3 vector (Fig 6) These results clearly indicate that the DNA sequences between )2000 and )351 and )351 and +200 contain neces-sary elements that can promote transcription We con-clude from these results that the human SAF-1 gene has at least two promoters

Discussion

In this paper, we describe a novel splice variant of SAF-1/MAZ/Pur-1 family of transcription factors that may be involved in regulating inflammation-induced expression of various SAF targets associated with pathogenic conditions In addition, we provide the first evidence of the existence of two promoters in the human SAF-1/MAZ/Pur-1 gene that permit transcrip-tion of multiple mRNAs with different N-termini The novel SAF-3 splice variant reported here is transcribed from the upstream promoter SAF-3 is predominantly expressed in cytokine- and growth factor-treated cells and in diseased tissues, but is barely detectable under normal conditions

A

B

C

Fig 5 Transactivation potential of SAF-3 (A) HTB-94 cells were

co-transfected with SAF3X-CAT2 reporter plasmid (0.5 lg) and

pCMV-bgal expression plasmid (0.4 lg) without ( )) or together

with (+) empty vector pcDNA3 (0.5 lg), pcDSAF-1 (0.5 lg) or

pcD-SAF-3 (0.5 lg) expression plasmid DNA, as indicated After 24 h,

cells were harvested and equivalent amounts of cell extracts were

assayed for CAT reporter activity The data shown represent the

mean ± SEM of three separate experiments (*P < 0.05 versus

control) (B) Western blot analysis of transfected cells with anti-His

tag IgG (C) CAT reporter assay HTB-94 cells were transfected

with 1.2VEGF-CAT reporter plasmid (0.5 lg) and pCMV-bgal

expression plasmid (0.4 lg) without ( )) or together with increasing

concentrations (0.2, 0.3, 0.4 and 0.5 lg) of 1 or

pcDSAF-3 expression plasmid DNA, as indicated After 24 h, cells were

harvested and equivalent amount of cell extracts were assayed for

CAT reporter activity The data shown represent the mean ± SEM

of three separate experiments (*P < 0.05).

A

B

Fig 6 SAF-3 mRNA is transcribed from an upstream promoter (A) Schematic drawing of the two promoter regions in the SAF gene (B) CAT reporter assay Each of the reporter constructs (0.5 lg) was co-transfected together with pCMV-bgal expression plasmid (0.4 lg) into HTB-94 cells After 24 h, cells were harvested and equivalent amounts of cell extracts were assayed for CAT reporter activity The data shown represent the mean ± SEM of three separate experiments (*P < 0.05).

Alternative splicing is a widespread mechanism of

gene regulation, and is also an efficient means of

increasing the diversity of proteins from a single gene

[27–29] This versatile mode of gene regulation is

uti-lized during development, sex determination, hormonal

regulation and apoptosis Deletion or inclusion of an

exon during splicing can generate a family of

transcrip-tion factors that may have subtle or dramatically

dif-ferent properties Due to such changes in specificity

and/or binding strength, one member can act as a

neg-ative regulator of another member In the SAF family

of Cys2/His2-type zinc transcription factors, the three

members that have been identified so far are generated

from a single gene by alternative splicing SAF-1 and

SAF-2 mRNAs initiate from the same start site

and thereby have identical N-termini but different

C-termini due to insertion of an exon in SAF-2 [23]

The SAF-3 mRNA is transcribed from an upstream

promoter and contains a totally different N-terminus

In addition, a portion of the first exon constituting the

N-terminus of SAF-1/SAF-2 mRNA is deleted in

SAF-3 mRNA (Figs 1 and 2) In previous studies, this

region of SAF-1/SAF-2 was shown to contain a

nega-tively functioning module [26] The SAF-2 isoform

activates SAF-1 under inflammatory conditions in a

unique fashion [23] Under normal conditions, SAF-2

negatively regulates SAF-1 transactivation, but, as

SAF-2 is down-regulated under various inflammatory

conditions, the repression of SAF-1 activity is relieved,

which permits a further increase in the expression of

SAF-1 targets In contrast to SAF-2, SAF-3 is

specifi-cally expressed during inflammation SAF-3 thus

appears to play a significant role in the pathogenic

conditions associated with increased expression of

many SAF target genes, due to the combination of

inflammation-responsive expression of SAF-3 and the

superior transactivation potential of SAF-3 The

underlying mechanism for the increased transcriptional

function of SAF-3 is presently unknown Increased

transcriptional activity of SAF-3 could result from

(a) a transactivating module present in the unique

N-terminus, (b) binding of the N-terminus by ancillary

factors, (c) the lack of a negatively functioning module

that is present in the N-terminus of SAF-1 [26], or (d)

all of the above

It was interesting to note the lack of a consensus

TATA box and/or CAAT box in both promoters of

the SAF gene In this regard, SAF-1/MAZ/Pur-1

resembles about the third of eukaryotic gene

promot-ers that do not contain a consensus TATA box

Another notable feature of the two SAF promoters is

the presence of a high frequency of CpG dinucleotides,

which are also known as CpG islands The CpG

islands have been shown to play an important role in epigenic control during mammalian development, and are frequently altered in many disease conditions such

as cancer [30–32] In addition, methylation of the cytosines of CpG islands in the promoter or the first exon has been shown to affect the rate of transcription [33], and ever since the clear demonstration of a causal relationship between hypermethylation of the promoter

of tumor suppressor genes and the development of cancer, it has been believed that transcription of many genes is repressed via DNA methylation [34] It remains to be investigated whether transcription from the upstream SAF promoter, i.e expression of SAF-3 mRNA, is regulated via DNA methylation

In conclusion, we show that the human SAF-1/ MAZ/Pur-1 gene has two promoters, which are utilized to produce multiple mRNAs with unique prop-erties A specific increase in the expression level of SAF-3 transcript transcribed from the upstream pro-moter may determine the level of SAF protein during inflammation and pathogenic conditions Further anal-yses of the factors that modulate transcriptional activ-ity of the upstream SAF promoter are necessary to clarify the mechanisms regulating increased expression

of SAF-3 during inflammatory conditions

Experimental procedures

Isolation, cloning and sequencing of the SAF-3 splice variant

A kgt-11 cDNA library was prepared using mRNAs iso-lated from IL-1b-induced human HTB-94 cells The library was screened using an SAF-1 cDNA probe The DNA inserts from the selected clones were sub-cloned in pTZ19U and sequenced One of these cDNA clones contained the SAF-3 sequence The promoter region of SAF-1/SAF-2/ SAF-3 was isolated by screening a human genomic DNA library in kEMBL3 (Clontech Laboratories Inc., Mountain View, CA, USA) with a full-length SAF-1 cDNA probe Three independent positive clones were selected Regions of the phage DNA spanning the human SAF gene were sequenced

Cell cultures and transfection Human HTB-94 chondrocyte cells, derived from a primary grade II chondrosarcoma, and human osteosarcoma Saos-2 cells were cultured in Dulbecco’s modified Eagle’s medium containing high glucose, 100 unitsÆmL)1 penicillin and

100 unitsÆmL)1 streptomycin supplemented with 7% fetal calf serum Both cell lines were obtained from the Ameri-can Type Culture Collection, Manassas, VA, USA)

Transfection assays were performed as described previously

[7] pSV-b galactosidase (Promega Corporation, Madison,

WI, USA) plasmid DNA was used as an internal control,

and was assayed as described previously [35] Cells were

harvested 24 h post-transfection, and CAT activity was

assayed as described previously [35] All transfection

experiments were performed at least three times

Plasmid constructs

The SAF3X-CAT2 reporter was constructed by ligating

three tandem copies of SAF DNA-binding elements into

the pBLCAT2 vector as described previously [23]

1.2VEG-F-CAT was constructed by ligating a 1.2 kb promoter

DNA fragment of human VEGF gene into the pBLCAT3

vector as described previously [5] Expression plasmids

pcDHis-SAF-3 and pcDHis-SAF-1 were constructed by

ligating full-length SAF-3 or SAF-1 cDNA into the

pCDNA3.1-His vector (Invitrogen, Carlsbad, CA, USA)

The ()2000/+200)SAF-CAT, ()2000/)351)SAF-CAT and

()351/+200)SAF-CAT plasmids were prepared by PCR

amplification of the respective DNA fragments of the

pro-moter region of human SAF gene followed by ligation into

the pBLCAT3 plasmid vector

Preparation of SAF-1 and SAF-3 proteins

For bacterially expressed SAF-1 and SAF-3 proteins, the

corresponding cDNAs were subcloned into the pRSET

vector (Invitrogen) Proteins expressed from these

con-structs were purified by nickel–agarose column

chroma-tography (Invitrogen) according to the manufacturer’s

protocol

Isolation of RNA and RT-PCR

Total RNA was isolated from untreated HTB-94 cells and

from HTB-94 and Saos-2 cells treated with IL-1b

(500 UÆmL)1) and TGF-b (5 ngÆmL)1), respectively, using

the guanidinium thiocyanate method [36] Total RNA was

isolated from synovial tissue of OA and RA patients as

described previously [37] Briefly, arthritic synovial tissue

was obtained from patients undergoing total knee joint or

hip replacement Synovial tissues were prepared from seven

RA knee joints and 14 OA knee joints Informed consent

was obtained from the patients according to ethical

guide-lines RT-PCR was performed using an RT-PCR kit

according to the manufacturer’s protocol (Invitrogen)

DNase-treated RNA (1 lg) was used in the reverse

tran-scription with random hexamers and oligo(dT)12–18as the

extension primer PCR was performed by denaturing at

94C for 2 min, followed by incubation at 94 C for 15 s

and 68C for 1 min for 40 cycles For detection of SAF-3

mRNA, nested PCR was performed In the first PCR, the

SAF-3-specific forward primer 5¢-CGCGAGCCACCT CCCTCCCTCC-3¢ and reverse primer 5¢-GCTTCAGG GCCGCTGTGTCCAC-3¢ were used, which produced a

345 bp product The reaction products were separated in an agarose gel, and a portion of the first PCR-amplified prod-uct (345 bp) was punched out using a Pasteur pipette and resuspended in 200 lL of sterile dH2O; 1.0 lL of this suspension was used as the template for the second PCR The SAF-3 primers for the second PCR primers were 5¢-CCGCCATGGATCCCAGCAACTGGAGCAGC-3¢ (forward) and 5¢-GAGAACCGGGAGCAAGTCCAC-3¢ (reverse) The amplification product of the second PCR was

208 bp The reaction products were resolved in a 1.5% aga-rose gel, and the identity of amplified DNA was verified by DNA sequence analysis The primers for the SAF-1-specific PCR were 5¢-CCATGTTCCCCGTGTTCCCTTGCACG CTG-3¢ (forward) and 5¢-GAGAACCGGGAGCAAGTC CAC-3¢ (reverse), and the amplification product was

271 bp The primers for MMP-9 were 5¢-GGCTCTCCAA GAAGCTTTTCTC-3¢ (forward; present in exon 10) and 5¢-CATAGCTCACGTAGCCCACTTGG-3¢ (reverse; pres-ent in exon 13), and the amplification product was 378 bp The primers for GAPDH were 5¢-TGCACCACCAACTG CTTAG-3¢ (forward) and 5¢-AGAGGCAGGGATGATGT TC-3¢ (reverse), and the amplification product was 177 bp

Northern blot analysis

A multiple-tissue Northern blot (Clontech Laboratories Inc.) was hybridized using a 32P-labeled oligonucleotide probe that contained the unique region of SAF-3 The sequence of the SAF-3 specific oligonucleotide probe is 5¢-CCAGGGTGAGCGCGAGCCACCTCCCTCCCTCCC TCCGCCATGGATCCCAGCAACTGGAGCAGCTTCAT CTTCCAG-3¢ After stripping off the probe, the same membrane was re-hybridized with a 32P-labeled SAF-1 cDNA probe containing the entire coding region (approxi-mately 1.4 kb)

Primer extension analysis For primer extension analysis, 0.5 lg of poly(A)+ RNA from IL-1b-induced HTB-94 cells was hybridized with a 5¢-end 32P-labeled, 18-base antisense oligonucleotide primer (5¢-GCTCCAGTTGCTGGGATC-3¢; 106 countsÆmin)1) corresponding to positions +4 to +21 with respect to the ATG start codon of the SAF-3 cDNA The probe and RNA were heated at 90C for 15 min in 80% formamide,

40 mm Pipes pH 6.4, 400 mm NaCl, 1 mm EDTA buffer, and then incubated overnight at 50C The annealed mRNA and oligonucleotide was ethanol-precipitated and resuspended in 50 lL of 50 mm Tris/HCl pH 8.3, 50 mm KCl, 10 mm MgCl2, 1 mm dithiothreitol, 0.5 mm spermi-dine, 1 mm each of the four dNTPs, 1000 UÆmL)1RNasin

(Promega) and 1000 UÆmL)1 AMV reverse transcriptase

(Promega), and incubated at 42C for 90 min The

sample was extracted with phenol/chloroform and

ethanol-precipitated As a negative control, yeast tRNA was used

as the template in a separate extension reaction The

prod-ucts of primer extension reactions were fractionated in a

12% polyacrylamide/urea sequencing gel

Preparation of SAF-3 and SAF-1 RNA by in vitro

transcription

To prepare SAF-3 and SAF-1 RNA transcripts, full-length

SAF-3 and SAF-1 cDNAs cloned into pTZ19U vector were

subjected to in vitro transcription using T7 RNA

polymer-ase and a commercial Riboprobe System T7 kit (Promega)

according to the manufacturer’s protocol The products

were fractionated in a 1% agarose gel, transferred to nylon

membrane and hybridized with radioactive SAF-3-specific

oligonucleotide probe

In vitro transcription and translation of SAF-3

protein

Full-length SAF-3 cDNA cloned into pTZ19U vector was

subjected to in vitro transcription and translation using a

TNT T7 coupled reticulocyte lysate system kit (Promega)

according tot the manufacturer’s protocol In vitro

tran-scription of SAF-3 mRNA was performed by using T7

RNA polymerase, and transcribed SAF-3 mRNA was

fur-ther in vitro translated and35S-labeled The control reaction

contained no plasmid DNA The reaction products were

fractionated by 11% SDS–PAGE and visualized by

auto-radiography

Western blot analysis

pcDNA3-His, pcDSAF-1 and pCDSAF-3

plasmid-trans-fected cells were lysed in 50 mm Tris/HCl pH 7.5, 100 mm

NaCl, 0.5 mm dithiothreitol, 1% Nonidet P-40, 0.1% SDS,

1 mm phenylmethanesulfonyl fluoride and 0.5 mgÆmL)1 of

benzamidine buffer, followed by mild sonication The

extracts (50 lg protein) were fractionated by 11% SDS–

PAGE and transferred to a nitrocellulose membrane To

evaluate the relative amount of proteins in each lane,

pro-teins were stained with Ponceau S solution (Sigma-Aldrich,

St Louis, MO, USA) Immunoblotting was performed using

a 1 : 5000 dilution of anti-His tag IgG (Millipore

Corpora-tion, Billerica, MA, USA) Bands were detected using a

chemiluminescence detection kit (Amersham Biosciences,

Piscataway, NJ, USA) In some Western blots, anti-SAF-3

serum was used to detect the SAF-3 protein level in

IL-1b-induced or unIL-1b-induced cells SAF-3 antibody was prepared

against the N-terminal epitope (MDPSNWSSFIFQ peptide)

that is absent in the SAF-1 and SAF-2 isoforms

Acknowledgements

This study was supported in part by US Public Health Service grants AR48762 and DK49205 and funds from the College of Veterinary Medicine, University of Missouri

References

1 Ray A & Ray BK (1998) Isolation and functional char-acterization of cDNA of serum amyloid A-activating factor that binds to the serum amyloid A promoter Mol Cell Biol 18, 7327–7335

2 Bossone SA, Asselin C, Patel AJ & Marcu KB (1992) MAZ, a zinc finger protein, binds to c-MYC and C2 gene sequences regulating transcriptional initiation and termination Proc Natl Acad Sci U S A 89, 7452–7456

3 Kennedy GC & Rutter WJ (1992) Pur-1, a zinc-finger protein that binds to purine-rich sequences, transacti-vates an insulin promoter in heterologous cells Proc Natl Acad Sci U S A 89, 11498–11502

4 Ray A & Ray BK (1996) A novel cis-acting element is essential for cytokine-mediated transcriptional induction

of the serum amyloid A gene in nonhepatic cells Mol Cell Biol 16, 1584–1594

5 Ray BK, Shakya A & Ray A (2007) Vascular endothe-lial growth factor expression in arthritic joint is regu-lated by SAF-1 transcription factor J Immunol 178, 1774–1782

6 Ray A, Shakya A, Kumar D & Ray BK (2004) Overex-pression of serum amyloid A activating factor 1 inhibits cell proliferation by the induction of cyclin-dependent protein kinase inhibitor p21WAF-1/Cip-1/Sdi-1 expres-sion J Immunol 172, 5006–5015

7 Ray A, Kuroki K, Cook JL, Bal BS, Kenter K, Aust G

& Ray BK (2003) Induction of matrix metalloproteinase

1 gene expression is regulated by inflammation-respon-sive transcription factor SAF-1 in osteoarthritis Arthritis Rheum 48, 134–145

8 Ray BK, Shakya A, Turk JR, Apte SS & Ray A (2004) Induction of the MMP-14 gene in macrophages of the atherosclerotic plaque: role of SAF-1 in the induction process Circ Res 95, 1082–1090

9 Ray A, Shakya A & Ray BK (2005) Inflammation-responsive transcription factors SAF-1 and c-Jun/c-Fos promote canine MMP-1 gene expression Biochim Biophys Acta 1732, 53–61

10 Ray A, Bal BS & Ray BK (2005) Transcriptional induc-tion of matrix metalloproteinase-9 in the chondrocyte and synoviocyte cells is regulated via a novel mecha-nism: evidence for functional cooperation between serum amyloid A-activating factor-1 and AP-1 J Immu-nol 175, 4039–4048