... permanent radioactive implants (brachytherapy) [7]. iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen depri- vation therapy (ADT) that ... Targeting uPA/uPAR in prostate cancer. Cancer Treat. Rev. 2007;33(6):521-7 3. Catalona WJ and Smith DS. 5-year tumor recurrence rates after anatomical radical retropubic prostatecto...
Ngày tải lên: 26/10/2012, 09:48
... Review Rasburicase represents a new tool for hyperuricemia in tumor lysis syn- drome and in gout Lisa Cammalleri and Mariano Malaguarnera Dept of Senescence, Urological and Neurological Sciences, ... monophosphate (GMP), the purinic nucleotides useful for DNA and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and...
Ngày tải lên: 31/10/2012, 14:59
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... session than in the first one, whereas the pleasantness of the heightened aroma sample increased in the second tasting session compared with the first one (interaction of age group and aroma and tasting, Fð1; ... The pleasantness of the heightened aroma sample increased during the home-use, while the pleasantness of the regular aroma sample remained virtually uncha...
Ngày tải lên: 03/04/2013, 21:06
Tài liệu Fourier and Spectral Applications part 1 ppt
... 538 Chapter 13 . Fourier and Spectral Applications Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-5 21- 4 310 8-5) Copyright (C) 19 88 -19 92 by Cambridge University ... copied into channel j − 1; and so on for both positive and negative values of k in r k . Figure 13 .1. 2 illustrates the situation. Example: a response function with r 0 = 1an...
Ngày tải lên: 21/01/2014, 18:20
Tài liệu FLUID-STRUCTURE INTERACTIONSSLENDER STRUCTURES AND AXIAL FLOW VOLUME 1 ppt
... 2.0 18 4 2. 016 6 2. 016 4 2. 016 3 2. 016 3 R2(El/m L4)-’I2 17 .16 6 16 .936 16 . 912 16 .906 16 .904 R3(El/m L4)-‘I2 - 52. I25 5 1. 826 5 1. 754 5 1. 738 CONCEPTS, DEFINITIONS AND METHODS 11 eigenvectors ... 302 303 314 315 316 316 317 327 328 328 333 336 348 348 348 366 368 387 392 394 394 402 412 413 415 415 417 417 4 21 42...
Ngày tải lên: 13/02/2014, 16:20
modeling with data tools and techniques for scientific computing oct 2008
... sequence and the ratio of the nth over the (n−1)st element for each n. gsl_stats July 10, 2008 gsl_stats July 10, 2008 Modeling with Data gsl_stats July 10, 2008 I COMPUTING gsl_stats July 10, 2008 gsl_stats ... arrive at writing a book on data- oriented computing using a general and basic computing language. For the purpose of modeling with data, I have foun...
Ngày tải lên: 11/06/2014, 13:32
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...
Ngày tải lên: 18/06/2014, 22:20
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt
... Jacques Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Héraud and Jean Marie Razafimahenina Chapter 5 Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier ... MATLAB – A Fundamental Tool for Scientific Computing and Engineering Applications – Volume 1 12 for i =1: Tam, if output(i) < 1 IAE_Val...
Ngày tải lên: 29/06/2014, 09:20
A textbook of Computer Based Numerical and Statiscal Techniques part 1 ppt
... This page intentionally left blank This page intentionally left blank A TEXTBOOK OF COMPUTER BASED NUMERICAL AND STATISTICAL TECHNIQUES Anju Khandelwal M.Sc., Ph.D. Department of Mathematics SRMS ... Based Numerical and Statistical Techniques is primarily written according to the unified syllabus of Mathematics for B. Tech. II year and M.C .A. I year students of...
Ngày tải lên: 04/07/2014, 15:20
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... program that packages information on the design and evaluation of evidence-based QI interventions into an integrated, easily accessible, and practical tool. In this paper, we provide a general ... relevant clinical practice guidelines (Clinical Practice Guidelines). It also discusses the why, what and how of measuring baseline performance defined as the measurement...
Ngày tải lên: 11/08/2014, 05:22
Materials Science and Engineering Handbook Part 1 pptx
... 48 .18 Cadmium 10 6 1. 22 10 8 0.88 11 0 12 .39 11 1 12 .75 11 2 24.07 11 3 12 .26 11 4 28.86 11 6 7.58 Indium 11 3 4.28 11 5 95.72 Tin 11 2 0.96 11 4 0.66 11 5 0.35 11 6 14 .30 11 7 7. 61 118 24.03 11 9 8.58 12 0 32.85 12 2 4.72 12 4 ... 0 .13 6 16 4 1. 56 16 6 33. 41 167 22.94 16 8 27.07 17 0 14 .88 18 6 1. 59 Thulium 16 9 10 0.0 18 9 16 .1 Ytterbium...
Ngày tải lên: 11/08/2014, 14:20