... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... bitter and more intense in currant flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was...
Ngày tải lên: 03/04/2013, 21:06
... [14] In addition, MGD has adopted the Mouse Embryo Anatomy Nomenclature Database [15] and the Anatomical Dictionary for the Adult Mouse [16] for annotating data that include anatomical attributes, ... systematic nomenclature Mech Dev 1998, 74:111-120 Hayamizu TF, Magan M, Corradi JP, Kadin JA, Ringwald M: The Anatomical Dictionary for the Adult Mouse: a tool for annotating and integrating data ... vascular defects abnormal vasculature o abnormal vascular dilation noted at E8.5 o vascular dilation was associated with an increased endothelial proliferation rate o in addition to the dilation,...
Ngày tải lên: 14/08/2014, 14:21
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... scans at a resolution of cm)1 The spectra were baseline corrected and normalized for equal area between 1711 and 1485 cm)1 Spectra were encoded every cm)1 Data analysis All spectra were treated ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers...
Ngày tải lên: 21/02/2014, 03:20
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt
... Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud and Jean Marie Razafimahenina Chapter Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier by Matlab/Simulink ... Balogh, Pavel Zỏskalický, S Chountasis, V.N Katsikis, D Pappas, Mohammed Z Al-Faiz, Abbas H Miry, Ramy Saad, Sebastian Hoyos, Samuel Palermo, Momoh-Jimoh E Salami, Ismaila B Tijani, Abdussamad ... Transformer Using Matlab 219 Adel Aktaibi and M Azizur Rahman Chapter 11 PH Control Using MATLAB 243 Mostefa Ghassoul Chapter 12 An Advanced Transmission Line and Cable Model in Matlab for the...
Ngày tải lên: 29/06/2014, 09:20
Báo cáo lâm nghiệp: "Wedge prism as a tool for diameter and distance measurement" ppsx
... of the angle gauge (b) b a (a) α borderline Table Average values and their differences Diameter measured optically with wedge prism Diameter measured with calliper Difference Standard deviation ... stem using the wedge prism as a tool for measurement is a sufficiently accurate method for measurement and can be used for measuring the diameters in the upper stem real position Use of the method ... between the stem volume and the diameter at breast height The method of measuring the diameter at a certain height of the tree is also appropriate for the sorting in standing trees For sorting one needs...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf
... genes annotated in the database and to improve the annotation features and abilities of the database The rate limiting step for input of data into the database is the manual reading of papers by annotators ... performed maintenance and updating of database functions and contributed to writing the manuscript DHL wrote the PHP and perl scripts to annotate and populate the database and worked on database ... NFI transcription factors Such data will be used when available Utility and Discussion Searching the database and displaying information: Basic Search Page The home page of the database is also...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: " The Rx for Change database: a first-in-class tool for optimal prescribing and medicines use" ppt
... summaries intervention characteristics, and outcomes from each review using a standardised data extraction form and a consensus process This ensures a consistent summary format for each review and ... the accuracy of the information Analysis and synthesis We analyse, summarise, and report separately the results of all relevant comparisons within each systematic review using quantitative and ... applicability, and quality Within a year of its launch, it had accumulated more than 25,000 page views With increasing awareness of the database and its ongoing updates, we anticipate that this...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... included footwear was also reported Intra-rater and inter-rater reliability for all categorical data was evaluated using percentage agreement, and kappa (κ) statistics [51,52] Kappa values above 0.80 ... Intra-rater ICCs and 95% LOAs for quantitative measures are shown in Table Similar intra-rater reliability was found for both raters across all measures Most quantitative measures demonstrated ... forefoot height, and longitudinal profile demonstrated at least substantial intra-rater reliability and at least moderate inter-rater reliability for all measures The percentage agreement statistic...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national or regional level ... Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto Grilli Italy: Center for the Evaluation ... project It is a software program that packages information on the design and evaluation of evidence-based QI interventions into an integrated, easily accessible, and practical tool In this paper, we...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt
... heart rate for activities of white-tailed deer J Wildl Manage 1980, 44, 333-342 Mesteig K, Tyler NJC, Blix AS: Seasonal changes in heart rate and food intake in reindeer (Rangifer tarandus tarandus) ... was only 99 h and 59 The HR data was transferred to a computer by Polar Precision Performance SoftwareTM for Windows® (Polar Electro Oy, Kempele, Finland) for further analysis Accuracy tests for ... correlation coefficient Figure The heart rates of reindeer calves in relation to different behaviour categories Data for each behaviour category has been calculated as an average of individual mean...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: "The Adult Mouse Anatomical Dictionary: a tool for annotating and integrating data" docx
... mouse microarray The Adult Mouse Anatomical Dictionary will be used as a resource to enable standardization and integration of many types of biological data pertinent to postnatal mouse anatomy, ... Ontology as a tool for annotating, analyzing, and comparing phenotypic information Genome Biol 2004, 6:R7 Adult Mouse Anatomical Dictionary Browser [http:// www.informatics.jax.org/searches/AMA_form.shtml] ... expand the vocabulary using a research datadriven approach This method included extensive evaluation of published biomedical research literature, as well as data with anatomical attributes that...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
Ngày tải lên: 14/08/2014, 16:21
THE AC/TC BACTERIAL RATIO: A TOOL FOR WATERSHED QUALITY MANAGEMENT
... (39) As is readily apparent, AC/TC and FC/FS ratios in fresh manure both start at values
Ngày tải lên: 05/09/2013, 09:08
Tài liệu DIGITAL LIBRARIES – A CHALLENGE FOR MEDICAL RESEARCH AND EDUCATION ppt
... research and digital libraries of the future is to handle the increasing automatization of the research sources in a way that makes these resources manageable and available to a broader audience ... European Database on AIDS and HIV infection a bibliographic database focused on grey literature and educational material produced by a group of European documentation centres specialized in AIDS and ... will make your local librarian rarer and rarer[Arms 2000] Another fact that also point in that direction is that one of the major costs for classic libraries are staff, facilities and materials,...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu Responsibility Charting: A Tool for Clarifying Roles docx
Ngày tải lên: 25/01/2014, 00:20
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... individual proteins in a pool of folded variants In addition, a rapid method for quantitatively, and simultaneously, characterizing a large number of mutants would greatly aid in understanding ... interaction with the specific binding partner (stability- or affinity-based), one could divide a phage library in half and sort one half against a binding partner and the other half against an expression...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc
... under any assignment of a node to the quantified variable, the formula is false Universally quantified formulae are evaluated similarly The evaluation of a boolean connective is a straightforward ... NEGRA export format (Brants, 1997) This format is designed for data exchange and to be readable by humans It is not very well suited as a format to be queried, because relations between nodes are ... therefore needs to opt for a general data structure And the one data structure that fits most easily with all treebank formats is that of a finite first-order structure One big advantage of the approach...
Ngày tải lên: 22/02/2014, 02:20
Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf
... translation In Proceedings of MT Summit X, pages 79–86, Phuket, Thailand Validation The tool also provides functionalities allowing users to create a database of manually validated MWEs from among ... syntactic configuration Then, each subset undergo a statistical analysis process whose aim is to detect those candidates that are highly cohesive A strong association between the items of a candidate ... is also automatically found, highlighted and displayed next to the original context (see Figure 1) Thus, users can see how a MWE has previously been translated in a given context Anna Anastasiadi-Symeonidi...
Ngày tải lên: 22/02/2014, 02:20