Nucleic acids have recently emerged as an important platform for selective molecular recognition, one major requirement for sensors. Long considered as passive molecules for the storage of genetic information, RNA and DNA molecules with catalytic function similar to protein enzymes were discovered in the early 1980s and 1990s, respectively [ 3– 5 ]. These enzymes are called ribozymes (catalytic RNA) and deoxyribozymes or DNAzymes (catalytic DNA). The nucleic acid enzymes usually require a metal ion co-factor to perform their catalytic function and can be tailored to be specifi c for a particular metal ion. In addition, nucleic acids that bind to a target molecule with high specifi city and affi nity (analogous to protein antibodies) have also been obtained, and these are called aptamers [ 6– 9 ]. Nucleic acid enzymes and aptamers have also been fused to form a new class of allosteric enzymes called aptazymes [ 10 , 11 ]. Collectively, the nucleic acid enzymes, aptamers, and aptazymes are termed functional nucleic acids.
As a major component of sensors, nucleic acids possess many advantages.
First, DNA/RNA targeting essentially any molecule of choice can be obtained through combinatorial selections [ 6–8 , 12 ], providing a unique opportunity to construct a general sensing platform for a broad range of analytes. This process is described in detail in the next section. Second, nucleic acids, particularly DNA, are very stable and can be denatured and renatured many times without losing their binding abilities, allowing a long shelf life. Third, nucleic acids have predictable base pairing interactions, which have been proven to be very useful for rational sensor design; such rational designs are diffi cult when making protein or organic molecule based sensors. Finally, DNA with a broad range of chemical modifi cations can be chemically synthesized with relatively low cost.
These properties make DNA/ RNA ideal candidates to create sensors. The examples discussed in this chapter mainly focus on DNA as the sensing molecule because DNA is much more stable than RNA and also less expensive, thus making it a more desirable candidate. It should however be noted that a large number of RNA aptamers and ribozymes are known and have been utilized to construct sensors. The stability of these nucleic acids can be further improved by chemical modifi cations and using nucleic acid analogs.
Savage_Ch29.indd 429
Savage_Ch29.indd 429 11/11/2008 4:25:37 PM11/11/2008 4:25:37 PM
29.2.1 In Vitro Selection of Functional Nucleic Acids That Are Selective for a Broad Range of Target Analytes
Although a number of naturally occurring ribozymes have been discovered in nature [ 3 , 4 ], DNAzymes and aptamers are obtained by a combinatorial biology technique called in vitro selection or called systematic evolution of ligands by exponential enrichment (SELEX) [ 6–8 , 12 ]. This technique can be used to obtain nucleic acid sequences that recognize a target contaminant with sensitivity and specifi city. Figure 29.1(a) is a schematic representation of the selection process.
Figure 29.1 In vitro selection of functional nucleic acids. (a) Schematic depiction of general in vitro selection scheme for obtaining functional nucleic acid that interacts with a specifi c target (contaminant). (b-e) Predicted secondary structures of selected metal specifi c RNA cleaving DNAzymes obtained by in vitro selection. The black strands represent the substrate and the green strands are the enzyme. The cleavage site is depicted by the black arrow.
Repeat rounds (a)
1015 Selection Amplification
In vitro selection
Selection Functional nucleic acid
winner
GTAGAGGTAGAGAAGGrATATCACTCA
G G
G A AA GG
G T T TT
TTAAACC C C
C C AG
C
CATCTCCATCTCTGCA ATAGTGAGT 3′ 5′ UO22+-dependent 39E DNAzyme (c)
GTGCAGGTAGAGAAGGrATATCACTCA CACGTACATCTCTTCA ATAGTGAGT
TG TT TT CT GG AA A
CGTTTTTACCTTC GA CA 3′
5′ Hg2+-dependent DNAzyme
(with UO22• cofactor) (d)
AGCTTCTTTCTAATACGGCTTACC AAGAAAGAAC CCGAATGG TTCTTTCTCCGGGT
TTT
3′ 5′ Cu2+-dependent DNAzyme (e)
Pb2+-dependent 17E DNAzyme (b)
5′ 3′ GTAGAGAAGGrATATCACTCA
CATCTCTTCT CC
CC C G G TGAGA A G
ATAGTGAGT
Savage_Ch29.indd 430
Savage_Ch29.indd 430 11/11/2008 4:25:37 PM11/11/2008 4:25:37 PM
A large pool of nucleic acid sequences represented by the colored objects (approximately 10 14 –10 16 diff erent sequences) is incubated with a target of interest in each round of selection. The “winner sequences,” which bind to the target analyte (in the case of aptamer selection) or catalyze a reaction in the presence of the target (in the case of nucleic acid enzyme selection), are separated by various techniques such as gel electrophoresis, column separation, and capillary electrophoresis. These “winners” are amplifi ed using polymerase chain reactions (PCR) and used for the next round of selection. During each round of selection, the stringency can be increased by decreasing the interaction time between the target and the nucleic acid, or by decreasing the concentration of the target. Iterative rounds of selection are continued until the pool is suffi ciently enriched with sequences of desired sensitivity and specifi city (represented by blue cubes in Fig. 29.1(a) ). This technique is particularly powerful as it provides a method for improving the specifi city for a given target by incorporating rounds of negative selection, wherein the pool is incubated with potentially competing targets and the sequences that interact with these are removed from the pool [ 13 ].
Finally, the winner molecules that are isolated are identifi ed by sequencing, and after some further biochemical and/or spectroscopic characterization they are used for diff erent applications, particularly sensing [ 12 , 14–20 ], therapeutics [ 21– 24 ], materials science, and nanotechnology [ 25– 27 ].
29.2.2 Analytes or Contaminants Recognized Selectively by Functional Nucleic Acids
In vitro selection has been used to obtain a number of metal specifi c DNAzymes, such DNAzymes that are dependent on Pb 2+ [ 28 , 29 ], Zn 2+ [ 30 ], Co 2+ [ 13 ], Cu 2+ [ 31 ], UO 2 2+ [ 32 ], Hg 2+ [ 33 ], As 5+ [ 33 ], some of which have been converted into fl uorescent and colorimetric sensors as described in the following sections. A number of these metal ions, notably Pb 2+ , Hg 2+ , As 5+ , are heavy metalions that are particularly toxic; UO 2 2+ is a radionuclide. The maximum contamination level of these metal ions in drinking water is strictly regulated by the U.S. EPA and few sensors can detect metal ions below those levels and selectivity of those sensors should also be improved in order to be practically applicable. Therefore the utility of DNAzymes as toxic metal sensors is of great importance. The predicted secondary structures of a few DNAzymes are shown in Fig. 29.1(b) . The strands in green represent the enzyme and the strands in black are the nucleic acid substrate. All the DNAzymes are RNA cleaving enzymes that catalyze the cleavage of a single ribo-linkage (represented by the arrow) embedded in the DNA substrate. Some of the fastest DNAzymes have a catalytic effi ciency (k cat /K m ) of 10 9 M –1 min –1 [ 34 ], rivaling that of protein enzymes and thus they are ideal for fast sensing.
The list of aptamers obtained by in vitro selection is even longer, and more importantly the analytes recognized are far more diverse and include small molecules, antibiotics, proteins, nucleotides, and even viruses and bacteria cells
Savage_Ch29.indd 431
Savage_Ch29.indd 431 11/11/2008 4:25:38 PM11/11/2008 4:25:38 PM
and other microbes. As the nucleic acid equivalent of antibodies, this fl exibility in the choice of targets for which aptamers can be obtained is a competitive advantage over antibodies for sensing applications [ 35 , 36 ]. Antibodies, on the other hand, cannot be raised against molecules too small to generate enough binding repertoires (e.g., metal ions not associated with any chelators), or compounds or proteins with poor immunogenic properties or with high toxicity.
An online searchable aptamer database that contains detailed information of aptamer sequences for diff erent analytes has been constructed by Ellington and coworkers [ 37 ]. Although a large majority of research in the fi eld of aptamers is devoted to aptamers for therapeutic applications [ 21– 24 ], their utility in nanotechnology and sensing has been widely explored [ 12 , 14–20 ].
Table 29.1 is a partial list of literature-reported functional nucleic acid targets that are considered contaminants in water or are being investigated as contaminants. The sensing of many pharmaceutical compounds, hormones, and receptors that are considered as emerging water contaminants benefi t from the research into aptamers for therapeutic applications. Also, as can be seen in Table 29.1 , aptamers are being developed for binding specifi cally bacterial cells, viral spores, and toxins that can be used as biological warfare agents.
It is quite clear that functional nucleic acids provide a unique recognition platform for a large range of diff erent contaminants that are already known and are emerging every year.
29.3 Functional Nucleic Acid-Directed Assembly of Nanomaterials for Sensing Contaminants
Since natural nucleic acids do not possess functional groups that can generate absorption in the visible region or fl uorescence, external signaling labels need
Table 29.1 Partial List of Literature-Reported Functional Nucleic Acids that Target Water Contaminants or Water Contaminant Candidates
Contaminant type Examples and references
Metal ions Pb2+ [28,29], Cu2+ [31], UO22+ [32], Hg2+ [33,38,39], As5+ [33], Zn2+ [30]
Radionuclides UO22+ [32]
Toxins Ricin [40], Abrin toxin [41], Microcystin [42]
Antibiotics Vasopressin [43], Streptomycin [44], Tetracycline [45], Viomycin [46], Chloramphenicol [47]
Endocrine disrupting compounds and hormones
17β -estradiol [48], Thyroxine hormone [49,50]
Protein HA1 proteins of H5N1 infl uenza virus [51]
Other small organic molecules Cocaine [15], Cholic acid [52],
(R)-thalidomide [53], Ethanolamine [54]
Cells and bacteria Anthrax spores [55], Campylobacter jejuni [56]
Savage_Ch29.indd 432
Savage_Ch29.indd 432 11/11/2008 4:25:38 PM11/11/2008 4:25:38 PM
to be applied to convert them into sensors. To achieve this goal, many organic fl uorophores and inorganic nanoparticles, which are summarized in the next few sections, have been employed.
29.3.1 Fluorescent Sensors
Fluorescent sensors provide an opportunity for on-site and real time sensing as recent advances have led to development of hand-held fl uorimeters that can be used as a stand-alone device or connected to a laptop computer. Also, fl uorescent sensors have the advantage of high sensitivity [ 57– 60 ].
Sensing metal ions using DNAzyme based fl uorescent sensors. Many metal specifi c DNAzymes have been successfully converted into fl uorescent sensors using a catalytic beacon technology [ 61 ]. The general design is illustrated in Fig. 29.2(a) . The catalytic beacon is engineered to place a fl uorophore (green sphere) on one substrate arm and a quencher (brown sphere) on the enzyme arm. When the sensor is assembled, the fl uorescence emission is quenched due to the proximity of the quencher to the fl uorophore, brought about by DNA hybridization. A second quencher on the other arm of the substrate helps to reduce background fl uorescence arising from non-hybridized substrate. In the presence of contaminant metal ion, the cleavage reaction causes the cleaved substrate fragment containing the fl uorophore to be released into solution, thus enhancing the fl uorescence strongly. The 17E DNAzyme was converted into a Pb 2+ sensor with a detection limit of 10 nM [ 29 ], which is lower than the U.S.
EPA threshold for Pb 2+ in water, set at 75 nM. Additionally, this sensor is over 80-fold more specifi c for Pb 2+ over highly competing metal ions Co 2+ and Zn 2+
and over 1,000-fold more specifi c over other divalent metal ions including Mg 2+
and Ca 2+ that are found in water. Figure 29.2(b) is the fl uorescent image of a microwell plate where the 17E DNAzyme is incubated with varying concent- rations of Pb 2+ and other competing metal ions. Concentration dependent enhanced fl uorescence is only seen for Pb 2+ . This technique has been tested on real-world water samples, such as from Lake Michigan, spiked with Pb 2+ .
Following this, a number of other ions, UO 2 2+ [ 32 ], Hg 2+ [ 39 ], and Cu 2+ [ 62 ], were converted into sensitive and selective fl uorescent sensors. The performance of the UO 2 2+ sensor is particularly impressive as the detection limit is reported to be 45 pM, which is not only lower than the EPA threshold (130 nM), but remarkably it is also lower than the detection limit for the widely used instrumental technique, ICP. Furthermore, the sensor has also been used to detect UO 2 2+
extracted from soil of a nuclear waste site, as these sites are dangerous sources for contamination of groundwater and surface water with radionuclides.
A number of other designs for the position of the fl uorophore–quencher have also been investigated and resulted in improvements in sensor designs [ 63 ]. In addition, new DNAzymes with fl uorescently modifi ed nucleotides were isolated by Li and coworkers [ 64 , 65 ] and utilized for metal sensing [ 66 ].
Sensing organic and biological molecules using aptamer-based fl uorescent sensors. A general approach for converting aptamers into fl uorescent sensors
Savage_Ch29.indd 433
Savage_Ch29.indd 433 11/17/2008 5:44:04 PM11/17/2008 5:44:04 PM
using the change in secondary structure of the aptamer upon target binding was reported by Li and coworkers ( Fig. 29.2(c) ). This method has been termed
“structure switching signaling aptamers”[ 16 ]. A tripartite assembly is made between a fl uorophore (green sphere) labeled DNA, a quencher (brown sphere) labeled DNA, and another linker DNA strand that contains the aptamer sequence and hybridizes to both the other strands, bringing the fl uorophore and quencher into close proximity, which leads to fl uorescence quenching.
Introduction of the target causes the aptamer to wrap around the target causing the disruption of base pairing interactions between the quencher containing DNA and the linker, thereby leading to its dissociation and subsequent fl uorescence enhancement. A number of alternates to this design have been reviewed [ 58 ] and aptamer based fl uorescent sensors have been demonstrated for organic molecules, proteins, and cells.
Figure 29.2 Fluorescent sensors using functional nucleic acid. (a) General design for a DNAzyme-based fl uorescent sensor for metal ion detection. The black substrate strand is labeled with a fl uorophore (green sphere) and quencher (brown sphere) and the green enzyme strand is labeled with a quencher (brown sphere). In the presence of specifi c metal ion, the enzyme catalyzed cleavage reaction causes the cleaved substrate fragments to be released and thus fl uorescence is unmasked. (b) Fluorescent image of a microwell plate with the Pb2+-dependent 17E DNAzyme incubated with diff erent metal ions. (c) General design for aptamer-based fl uorescent sensor. In the presence of target (red star), the aptamer sequence (green line) undergoes structure switching to wrap around the target, thereby disrupting the base pairing and releasing the quencher from this assembly.
Trace metal
(a) (c)
Ni2+
5 μM 2 μM 1 μM 0.5 μM
Cd2+ Mn2+ Zn2+ Mg2+ Co2+ Pb2+ H2O (b)
Savage_Ch29.indd 434
Savage_Ch29.indd 434 11/11/2008 4:25:39 PM11/11/2008 4:25:39 PM
29.3.2 Colorimetric Sensors
Although fl uorescent sensors are a very sensitive method for contaminant detection, they still require an instrument and the organic fl uorophores can photo bleach relatively quickly. Colorimetric sensors eliminate the need for instruments and the following two sections discuss the use of metallic nanoparticles for the development of these sensors.
Sensing metal ions using DNAzyme/gold nanoparticle-based colorimetric sensors. Gold nanoparticles (AuNPs) make an attractive candidate for colorimetric labels as they have a very strong extinction coeffi cient (10 8 ε cm –1 for 13 nm AuNPs, which is about three orders of magnitude higher than the best organic chromophores) and they display distance dependent optical properties. Dispersed nanoparticles are red in color, whereas aggregated nanoparticles are blue/purple in color. A quantitative analysis can be carried out by measuring the absorbance of the samples, for which portable colorimeters are also available. In 1996, Mirkin and coworkers utilized the DNA induced assembly of AuNPs to make a colorimetric sensor for nucleic acids [ 67 ]. Lu and coworkers expanded the scope of sensing to analytes beyond nucleic acids, by combining AuNPs with DNAzymes [ 68– 71 ]. The sensing method is depicted using the Pb 2+ dependent 17E DNAzyme as a representative example ( Fig.
29.3(a) ). AuNPs functionalized with short thiol modifi ed DNA are assembled on the arms of the extended substrate, which is in turn hybridized to the enzyme. Since each AuNP is functionalized with many DNA strands, blue aggregates are formed. In the presence of Pb 2+ , the enzyme catalyzed cleavage of the substrate will disassemble the aggregate producing red color. The color can be spotted on a thin layer chromatography (TLC) plate and one such representative test is shown in the inset of Fig. 29.3(a) . Red color of increasing intensity is seen with Pb 2+ , whereas the sensors containing other metals are blue. The reaction is fast with color change occurring within 10 minutes under optimized conditions and the detection limit is approximately 100 nM.
A unique feature of this sensor is that the dynamic range of the sensor can be tuned by careful mutation of the DNA sequence, which is very useful for making sensor systems that can change colors at diff erent threshold levels that match the maximum contaminant levels (MCLs) defi ned by EPA or CDC. The dynamic range of the Pb 2+ sensor was shifted from 10 to 100 μM Pb 2+ using this strategy [ 68 ].
Sensing organic and biological molecules using aptamer/gold nanoparticle- based colorimetric sensors. To detect contaminants beyond metal ions, aptamers have been used instead for directed assembly of nanomaterials such as gold nanoparticles [ 19 ]. Figure 29.3(b) is an illustration of the detection scheme using an adenosine (A) aptamer. Two types of oligonucleotide functionalized AuNPs (particles 1 and 2) are assembled on a linker DNA consisting of the adenosine aptamer. The addition of adenosine induces structure switching, leading to disassembly of the blue aggregate, producing a red color characteristic of dispersed AuNPs, which is not seen in the presence of control analytes (C),
Savage_Ch29.indd 435
Savage_Ch29.indd 435 11/11/2008 4:25:41 PM11/11/2008 4:25:41 PM
cytidine (C), uridine (U), and guanine (G) (inset of Fig. 29.3(b) ). The generality of this method has been demonstrated by making a cocaine sensor in the same manner. Sensors that respond to multiple chemical stimuli have also been constructed by combining two aptamers in the same system [ 72 ] such that the sensor responds either in the presence of both analytes just one of the analytes.
Recently, a new method has been reported for colorimetric sensing utilizing AuNPs, called the label free method [ 73 ]. Here the AuNPs do not need to be functionalized with thiol modifi ed DNA, and thus there can be signifi cant reduction in sensing costs as the DNA utilized will not require the chemical (thiol) modifi cation required for attaching DNA to AuNPs. This method is based on the principle that single stranded DNA (ssDNA) can adsorb on
Figure 29.3 Colorimetric sensors using functional nucleic acid. (a) DNAzyme based colorimetric sensor for Pb2+ detection. In the absence of Pb2+, the oligonucleotide functionalized gold nanoparticles (AuNPs) are assembled on the substrate to form blue aggregates. When Pb2+ is present, the substrate is cleaved and the aggregate is disassembled to yield red colored dispersed AuNPs. Inset: Picture of sensor incubated with increasing concentrations of Pb2+ and other metal ions. (b) Aptamer-based sensor for colorimetric detection of adenosine. Nanoparticles 1 and 2 are functionalized with two diff erent DNA molecules through thiol-gold chemistry. The two kinds of AuNPs are linked by LinkerAdap to form aggregates. In the presence of adenosine, the AuNPs disassemble to give dispersed red nanoparticles. Inset: Photograph of the samples with designated nucleoside added.
Sensor
no Pb
2+
Pb2+
Aggregate
Co
0 0.25
LinkerAdap
Adenosine aptamer 3′ 5′3′
0 mm A0.5 mm A1 mm A2 mm A2 mm C2 mm U2 mm G
5′ 2 1
2 (a)
(b)
2
=Adenosine 2
1
1 1
2 2
2 1
1
s s
s-
-s
0.5 1 2 3
Zn Cd Mn Ni Ca Mg (5μM)
5 μM Pb
Savage_Ch29.indd 436
Savage_Ch29.indd 436 11/11/2008 4:25:41 PM11/11/2008 4:25:41 PM
AuNPs more eff ectively and therefore protect them from salt induced aggregation to a greater extent as compared to double stranded DNA or structured DNA, such as quadruplex DNA. Aptamer-based sensing has been demonstrated for some analytes by utilizing the change in the DNA secondary structure upon target binding [ 74– 76 ].