why use a single page website

Tìm hiểu angularjs framework và xây dựng single page site ( website bán điện thoại trực tuyến)

Tìm hiểu angularjs framework và xây dựng single page site ( website bán điện thoại trực tuyến)

... của Angular Framework 7 1.3 Ưu nhược điểm của Angular Framework 8 1.4 Tại sao chúng ta nên sử dụng Angular Framework 9 1.5 Cấu trúc của thư mục Angular Framework 9 Chương 2: CÀI ĐẶT ANGULAR ... 1.3 Ưu nhược điểm của Angular Framework Bảng 1.3 1 Ưu nhược điểm của Angular Framework - Cung cấp khả năng tạo ra các Single Page Aplication dễ dàng - Cung cấp khả năng data binding tới HTML, ... dụng của vô hiệu hóa JavaScript thì sẽ chỉ nhìn thấy trang cơ bản Trang 201.4 Tại sao chúng ta nên sử dụng Angular Framework Hình 1.4 1 Tạo sao chúng ta nên sử dụng angular 1.5 Cấu trúc của thư

Ngày tải lên: 28/11/2021, 16:33

110 13 0
Appropriate use criteria of transesophageal echocardiography in Greece: A single center experience

Appropriate use criteria of transesophageal echocardiography in Greece: A single center experience

... Foundation (A.C.C.F) along with the American Society of Echocardiography (A.S.E.) have enabled a more accurate and clinically oriented evaluation of echocardiography indications in cardiology patients ... indication (3) Statistical analysis Continuous variables are expressed as mean ± standard deviation while nominal/ordinal variables in absolute or percentage value (%) Normal distribution of variables ... esophageal varices or esophageal achalasia were excluded Methods Trang 7by using appropriate questionnaires In addition to, CV related treatment as well as the prevalence of the main CV risk factors

Ngày tải lên: 19/11/2022, 11:42

23 6 0
TÌM HIỂU ANGULARJS VÀ ÁP DỤNG XÂY DỰNG WEBSITE SINGLE PAGE APPLICATION BÁN ĐIỆN THOẠI DI ĐỘNG - Full 10 điểm

TÌM HIỂU ANGULARJS VÀ ÁP DỤNG XÂY DỰNG WEBSITE SINGLE PAGE APPLICATION BÁN ĐIỆN THOẠI DI ĐỘNG - Full 10 điểm

... của whatever works for you) Hình 1.5: Mô hình MVC và MVW của AngularJS 1.2.6 Single Page Application – SPA Một single page application hay còn gọi là single page interface, là một web app hay ... one-way databinding và two-way databinding của AngularJS 9  Hình 1.4: Mô hình MVC 9  Hình 1.5: Mô hình MVC và MVW của AngularJS 10  Hình 1.6: Mô hình website Single Page Application 11  ... tạo ra thẻ như sau <draggable> drag me </draggable > Các văn bản bên trong tag draggable bây giờ sẽ trở thành draggable trong trình duyệt, sau đó chỉ cần viết mô ̣t định nghĩa chỉ

Ngày tải lên: 27/02/2024, 20:19

62 3 0
Chuyên đề thực tập: Xây dựng website kết nối các công ty du lịch theo hướng Single Page Application

Chuyên đề thực tập: Xây dựng website kết nối các công ty du lịch theo hướng Single Page Application

... thông, có thê thực hiện được nhiều UseCase : —<—— La thành phan co ban nhất của so đồ UseCase UseCase ( Usercase ) Được biéu diễn bằng hình elip Mỗi UseCase >> | hiển thị một chức năng ... framework của Javascipt sẽ được em dùng để thiết kế phần FrontEnd Là framework sinh sau dé muộn nhất nếu so với các AngularJs hay ReactJs Những framework như vừa kể trên có thể giúp việc tạo ra ... này thì em sẽ dùng Laravel 7.x 10 Trang 162.3.3 Tai sao nên lựa chọn Laravel ?= Được thừa hưởng những thế mạnh của các framework khác = Có số lượng người dùng nhiều đồng nghĩa có nhiều thư viện

Ngày tải lên: 11/04/2024, 20:37

44 3 0
iec 60332-1 tests on electric cables under fire conditions - test on a single vertical insulated

iec 60332-1 tests on electric cables under fire conditions - test on a single vertical insulated

... international unification, IEC National Committees undertake to apply IEC International Standards transparently to the maximum extent possible in their national and regional standards Any divergence ... sujet traité peut participer Les organisations internationales, gouvernementales et non gouvernementales, en liaison avec la CEI, participent également aux travaux La CE1 collabore étroitement avec ... Standard and the corresponding national or regional standard shall be clearly indicated in the latter This International Standard IEC 332-1 has been prepared by sub-committee 20C: Burning characteristics

Ngày tải lên: 25/12/2013, 10:59

23 501 1
iec 60332-2 tests on electric cables under fire conditions - test on a single small vertical insu

iec 60332-2 tests on electric cables under fire conditions - test on a single small vertical insu

... approval t e s t i n g or may be r e f e r r e d t o in cable standards One sample o f insulated w i r e or cable, a f t e r having been tested i n accordance with Clauses 6, 7 and 8, shall ... flame propagation u n d e r a l l conditions of installation When t h e r i s k o f propagation is high, such as assumed that because a sample complies w i t h t h i s s t a n d a r d t h e ... la C E I: Vocabulaire Electrotechnique International (VEI) qui est établie sous forme de chapitres séparés traitant chacun d'un sujet défini l'Index général étant publié sépa- rément Des détails

Ngày tải lên: 25/12/2013, 10:59

13 403 1
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

... oligonucleotide primers Aprom (forward): 5¢-CGC ATC GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI ... A single nuclear mutation causes both the absence of functional PSII and the lack of PG-C16:1(3t) The mf1 and mf2 mutants were originally screened as unusual PSII mutants because they lack variable ... It was subsequently proven that changes in supramolecular organization of the peripheral antenna were due to the absence of one particular fatty acid, C16:1(3t), which probably causes a decrease

Ngày tải lên: 07/03/2014, 15:20

10 411 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

... Trang 1a single amino acid catalytic center?Supporting amino acid residues at the active site of penicillin G acylase Diana Zhiryakova1, Ivaylo Ivanov2, Sonya Ilieva3, Maya Guncheva1, Boris Galunsky4and ... 25 Yamagami C, Takao N, Tanaka M, Horisaka K, Asada S & Fujita T (1984) A quantitative structure–activity study of anticonvulsant phenylacetanilides Chem Pharm Bull 32, 5003–5009 26 Birnbaum ... terminal nucleophile) hydro-lase family Croatica Chim Acta 73, 901–908 3 Perakyla M & Kollman PA (1997) A simulation of the catalytic mechanism of aspartylglucosaminidase using ab initio quantum

Ngày tải lên: 16/03/2014, 01:20

10 427 0
Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

... polar residue His18 in A thaliana SCP-2 is replaced by Phe17 in E lagascae SCP-2, and the polar residue Glu22 in E lagascae SCP-2 is replaced by Ala23 in A thaliana SCP-2 E lagascae SCP-2 also ... Curiously, A thalianaSCP-2 and also all other plant SCP-2s that we have identified are single-domain polypeptides, whereas, as indicated above, SCP-2 domains in ani-mals and many other eukaryotes are ... E lagascae and A thaliana SCP-2 mutants Normalized decrease in BODIPY-PC transfer rate mediated by different A thaliana and E lagascae SCP-2 mutants (10 lg) upon introducing ergosterol or palmitic

Ngày tải lên: 16/03/2014, 12:20

15 392 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

... (Ground data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in the watershed area 17 Suggestion zones for sustainable of watershed ... implementation such as rubber plantation and irrigation system were installed in the area, and than this place was changed in dynamics way of land use system • The forest area was destroyed by increasingly ... private agencies As we know, GIS and remote sensing have an important role in linkage and analysis of such data, in particular for detection, interpretation, area calculation, monitoring and

Ngày tải lên: 17/03/2014, 11:20

24 898 0
Why Use Video For Your Online Business pptx

Why Use Video For Your Online Business pptx

... they have replaced reading as a means of entertainment, as well as a means of gaining information With the Internet having so much video availability, many people do all their “research” via video ... Blogs are much worse for this than websites Essentially, articles that are placed on a blog are seen that day and maybe a few days afterwards While some blog visitors will go back through the archives ... operation, provides valuable information to the customer and adds to your credibility Smart consumers tend to read claims about a product with a grain of salt Many automatically reduce the capability

Ngày tải lên: 18/03/2014, 03:20

57 268 0
How To Use Facebook Business Page pptx

How To Use Facebook Business Page pptx

... disseminationsignificantly easier New Navigational Features – Facebook business pages have navigational features that make it easy for customers to viewproducts, services and other updates that are ... setting up a landingpage on your facebook business page, a Google search reveals a lot of great free tutorials Familiarizing Facebook Terms and Conditions As you create your facebook business page, ... business page. Now, you are ready to customize the facebook business pagethat you have just created Facebook has multiple applicationsthat you can use to create a unique look and feel to yourfacebook

Ngày tải lên: 20/03/2014, 17:21

65 250 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

... unfolding rate changes with an applied force, we can obtain estimates for the values of both ku0andDxu Given that ku0= A expACHTUNGTRENNUNG( DGu/kBT) and assuming a pre-factor, A~ 1013s 1,[39] we can ... gap between separatingb-strands In Figure 5 B, we define the pulling coor-dinate for the A’ and Gb-strands as the distance between the first amino acid of strand A’ (Y9) and the last amino acid ... coordinate for the separating b-strands is defined as the distance be-tween the first amino acid of strand A’ (Y9) and the last amino acid of strand G (K87) The elongation of the x(Y9) x(87) distance

Ngày tải lên: 22/03/2014, 18:20

12 557 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

... For all plasmid amplifications and isolations Escherichia coli strain DH5a was used (Invitrogen, Carlsbad, CA, USA) The yeast wild-type strain BY4742 was used The strain BY4742pex5D was obtained ... (Kansas City, KS, USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA ... monoclonal anti-bodies against GFP combined with rabbit anti-HEX1 serum The secondary antibodies used were Alexa Fluor 488-labeled anti-mouse IgG and Alexa Fluor 594-labeled anti-rabbit IgG Bar =

Ngày tải lên: 23/03/2014, 07:20

10 351 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... variants; mutation rate 0.9%) obtained from scFv 3F was evaluated by phage display against Cn2 toxin Variant 6F was selec-ted (Table 2), which had a change (Ser54Gly) in CDR2 of the heavy chain ... comments on the Biacore results We are indebted to DVM Elizabeth Mata, DVM Barbara Mondrago´n and Mr Sergio Gonza´lez for invaluable help and animal provision We also thank Dr Paul Gayta´n, Eugenio ... was generated by RT-PCR from total RNA purified from B lymphocytes of human periph-eral blood To avoid, as far as possible, a bias in anti-body variable chain family representation, each V family

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx

Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx

... Trang 1and catalytic activity in a bacterial quinone reductaseAlexandra Binter1, Nicole Staunig2, Ilian Jelesarov3, Karl Lohner4, Bruce A Palfey5, Sigrid Deller1, Karl Gruber2and Peter Macheroux1 ... free FMN and are summarized inTable1 The native molecular mass was estimated by mole-cular sieve chromatography Each protein variant eluted as a single species; however, all protein variants exhibited ... reductase activity was severely compromised in all variants because of a lack of reduction of the FMN cofactor by NADPH This was clearly unexpected because all variants appear to have A B Fig 5 Close-up

Ngày tải lên: 30/03/2014, 01:20

12 409 0
Using Oracle Clusterware to Protect A Single Instance Oracle Database 11g pot

Using Oracle Clusterware to Protect A Single Instance Oracle Database 11g pot

... Trang 1 A Single Instance Oracle Database 11g An Oracle Technical White Paper February 2008 Trang 2in this document A resource group acts as a container for the managed resources Oracle ... – as detailed in this paper, you must not use these commands against any Oracle RAC resources Oracle RAC resource names typically start with “ora.” It is a best practice that you do not name any ... Install a Clustered ASM home and create an ASM instance [optional step] If you choose to locate your database files inside ASM then you should install an ASM home across the nodes and create an

Ngày tải lên: 30/03/2014, 13:20

28 703 0
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot

Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot

... Trang 1inactivates the enzyme without affecting RNA bindingMo´nica Amblar and Cecı´lia M Arraiano Instituto de Tecnologia Quı´mica e Biolo´gica ⁄ Universidade Nova de Lisboa, Oeiras, Portugal ... demonstrate that the single amino acid sub-stitution Asp209fiAsn in RNase II is able to cause the total inactivation of the enzyme without affecting its RNA binding capability In addition, metal ions ... Sigma Genosys (Cambridge, UK) Bacterial strains, plasmids, and RNA substrates The E coli strains used were JM109 [F¢ (traD36 proA +-B+lacIqD(lacZ)M15 ⁄ D(lac-proAB) glnV44 e 14–gyrA96 recA1 relA1

Ngày tải lên: 30/03/2014, 15:20

12 321 0
business model you a one-page method for reinventing your career

business model you a one-page method for reinventing your career

... MannilaMohamad KhawajaNatasja la LauNathalie MénardNathan Robert MolNathaniel SpohnNei GrandoNiall DalyNick NiemannNicolas De SantisOliver BueckenOlivier J VavasseurOrhan Gazi KandemirPaola ValeriPatrick ... Heathfi eld Allan Moura Lima Bryan LubicCamilla van den BoomCarl B SkompinskiCarl D’AgostinoCarles Esquerre VictoriCarlos Jose Perez FerrerCaroline ClelandCassiano FaraniCatharine MacIntoshCesar ... van den Berg PK RasamRahaf HarfoushRainer BareißRalf de GraafRalf MeyerRavinder S SethiRaymond GuyotRebecca Cristina C Bulhoes Silva Reiner WalterRenato NobreRiaz PeterRichard BellRichard Gadberry

Ngày tải lên: 29/05/2014, 14:38

257 413 0
Chap12: Hypothesis testing:  Describing a single population

Chap12: Hypothesis testing: Describing a single population

... can use two different approaches:The rejection region approach (typically used when computing statistics manually), and The p-value approach (which is generally used with a computer and statistical ... random sample of 400 monthly accounts is drawn, for which the sample mean is $178 The manager knows that the accounts are approximately normally distributed with a standard deviation of $65 Can the ... favour of HA… one-tail test Trang 33Example 1: The Big Picture AgainTrang 34• Step 1: Null and alternative hypotheses: H 0 :  = 170 H A :  > 170 • Step 2: Test statistic: Z has a standard

Ngày tải lên: 05/06/2014, 08:39

115 446 0
w