which one of these is a foliated metamorphic rock

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by which ... preparations indicated Statistical analysis was by Student’s paired t test Fig Time course of inactivation of phosphorylase a (A) and activation of glycogen synthase (B) by 10 nM insulin Hepatocytes ... synthase, and that the former mechanism alone cannot explain the stimulation of glycogen synthesis This suggests that translocation of glycogen synthase may be an essential component of the mechanism...

Ngày tải lên: 31/03/2014, 01:20

9 383 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT...

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

... characterization of hSRP1 gamma, a tissue-specific nuclear transport factor Proc Natl Acad Sci USA 95, 582–587 10 Kamei Y, Yuba S, Nakayama T & Yoneda Y (1999) Three distinct classes of the alpha-subunit ... standard curve, and normalized to the housekeeping gene, hypoxanthine-guanine phosphoribosyltransferase Statistical analysis All data are expressed as the means ± standard deviations or standard ... immunoblotting and immunohistochemistry: a rat monoclonal antibody against importin a1 (Yasuhara et al., submitted) (1 : 500), antiKPNA4 IgG (ab6039; Abcam, Cambridge, MA, USA) (1 : 2000), goat anti-importin...

Ngày tải lên: 28/03/2014, 23:20

12 347 0
báo cáo hóa học:" Sang Froid in a time of trouble: is a vaccine against HIV possible?" pot

báo cáo hóa học:" Sang Froid in a time of trouble: is a vaccine against HIV possible?" pot

... that are highly efficacious They are almost always needed for inactivated vaccines, e.g tetanus, diphtheria, and polysaccharide conjugates (exceptions are hepatitis A and hepatitis B), and are often ... rotavirus vaccine This was an orally administered mixture of a simian rotavirus and reassortants of human and simian rotaviruses in which the simian virus contributed 10 of the 11 double-stranded ... genital tract [115], and there is recent work suggesting that sublingual administration of antigens may be a way around compartmentalization of mucosal immunity [116] (see table 7) Page of 12 (page...

Ngày tải lên: 20/06/2014, 08:20

12 424 0
Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps

Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps

... presence of bacterial colonisation and high bacterial load were a more severe degree of dyspnoea and a darker colour of sputum The degree of dyspnoea is a marker of severity of COPD and being a categorical ... interpretation of data and wrote the manuscript EM, JM and AT designed the study, and participated in the analysis and interpretation of data AM and SV recruited the patients, collected data and participate ... speculate that change in bacterial load was unlikely to be a major primary mechanism of exacerbation induction in COPD [27,28] This hypothesis is a matter of debate, because the interpretation of...

Ngày tải lên: 12/08/2014, 11:21

9 395 0
Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

... nuclear atypia, increased mitotic activity, vascular thrombosis, microvascular proliferation and necrosis Similar to anaplastic astrocytoma, glioblastoma may arise de novo as glioblastoma or may ... tumour This data is substantiated with observation that 9.4% of anaplastic astrocytoma patients had at least one first degree relative with an astrocytic tumour50 A significant proportion of patients ... potentiate adjuvant therapy It is likely that the chemoresistance properties are potentiated by autocrine and paracrine pathways and facilitated by mitogenic agents Local tissue invasion distinguishes...

Ngày tải lên: 14/09/2015, 12:13

203 290 0
Báo cáo hóa học: " A common fixed point theorem for a commuting family of nonexpansive mappings one of which is multivalued" pdf

Báo cáo hóa học: " A common fixed point theorem for a commuting family of nonexpansive mappings one of which is multivalued" pdf

... 3.7 Let A be a compact convex subset of a Banach space X and let a nonempty subset F of A be a nonexpansive retract of A Suppose a mapping U : A ® KC (A) is upper semi-continuous and satisfies: ... was stated that: Let E be a nonempty weakly compact convex subset of a Banach space X Suppose E has (HFPP) Suppose F is a nonempty nonexpansive retract of E and t : E ® E is a nonexpansive mapping ... doi:10.1016/j.jmaa.2005.03.055 Shahzad, N, Markin, J: Invariant approximations for commuting mappings in CAT(0) and hyperconvex spaces J Math Anal Appl 337 (2008) Dhompongsa, S, Khaewcharoen, A, Khaewkhao, A: ...

Ngày tải lên: 20/06/2014, 22:20

10 396 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx

Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx

... quality of banking and regional growth Hasan, Koetter, Wedow 11 2007 Welfare effects of financial integration Fecht, Grüner, Hartmann 12 2007 The marketability of bank assets and managerial Falko ... demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International investment positions and Michael Binder exchange rate dynamics: a dynamic panel analysis Christian J Offermanns 24 2007 ... Loretan 25 11 2007 Exchange rate dynamics in a target zone a heterogeneous expectations approach Christian Bauer Paul De Grauwe, Stefan Reitz 12 2007 Money and housing evidence for the euro area and...

Ngày tải lên: 22/03/2014, 23:20

40 470 0
THE SENTENCE (A sentence is a group of words which expresses a complete thought.)

THE SENTENCE (A sentence is a group of words which expresses a complete thought.)

... Sentence A declarative sentence  A declarative sentences make statements or assertions For example:  I shall arrive at there  We must not forget that date 2.An imperative sentence  An imperative ... an exclamation mark For example:  What a beautiful girl !  He is going to win ! The Four Sentence Structures  A sentence can consist of a single clause or several clauses When a sentence is ... sentence is a single clause, it is called a simple sentence (and the clause is called an independent clause) A sentence must contain at least one independent clause  Below are the four types of sentence...

Ngày tải lên: 13/07/2014, 23:26

11 589 0
Rocks – a rock is a collection of one or more minerals

Rocks – a rock is a collection of one or more minerals

... dissolved in the sea water These rocks usually form as the ocean water evaporates away and leaves the dissolved minerals behind These are also monominerallic Bioclastic/Organic – rocks formed from ... none at all (glass) Ms Hartnett's Earth Ms Hartnett's Earth Metamorphic Rocks – rocks that have been changed by the action of heat and pressure from occurrences inside the Earth Metamorphic rocks ... minerals and are not the same throughout Some (very few) rocks are homogeneous or monominerallic This means that they are made of only one type of mineral and they are the same throughout Rocks are...

Ngày tải lên: 30/11/2016, 16:20

9 237 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation...

Ngày tải lên: 25/10/2012, 10:31

9 635 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... diagnosis of sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors read ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...

Ngày tải lên: 25/10/2012, 10:35

10 599 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

... to grammatical forms, or grammatical means of expression, such as a clause and a nominal group According to Halliday, grammatical metaphor is conceived as an incongruent realization of a given ... Levels of Language, Metafunction, Instantiation, Rank and Nominal Group Language and Social Context Systemic Functional Grammar was established as a linguistic theory by M .A. K Halliday It is a theory ... process is normally expressed by means of a clause, but it can metaphorically be expressed by means of a noun phrase What is important is that a noun phrase is also the ‘normal’ (i.e default, standard)...

Ngày tải lên: 07/11/2012, 14:44

53 1K 3
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... these arguments differ from that of the stem paragraph (A) is a valid argument: Given anything that is a war, if any war is to be condemned, then all wars are to be condemned (B) is not a valid argument ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...

Ngày tải lên: 20/01/2014, 20:20

696 1K 1
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... on the camera Absolute rock bottom You'll see cameras advertised as LUX or LUX cameras LUX is equal to 19 foot candles LUX is about 37 foot candles I was suspicious, so a number of years ago I ... or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode where you can control...

Ngày tải lên: 26/01/2014, 04:20

6 468 1
Learning english is a piece of cake 1

Learning english is a piece of cake 1

... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ...  In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...

Ngày tải lên: 27/01/2014, 20:11

2 1,7K 15
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Austrian Science ... gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 ... PTI1-4 (At2g47060) was cloned in the pBD-GAL4 cam (Stratagene, La Jolla, CA, USA) and were each used as bait to screen an Arabidopsis pACT2 cDNA library [36] The yeast strain PJ69- 4A [37] containing...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
w