wait a minute does everybody like compliments

Neither a Borrower Nor a Lender: Does Chinas Zero Net Foreign Asset Position Make Economic Sense?

Neither a Borrower Nor a Lender: Does Chinas Zero Net Foreign Asset Position Make Economic Sense?

... Trang 1Neither a Borrower Nor a Lender: Does China's Zero Net Foreign Asset Position Make Economic Sense? David Dollar and Aart Kraay The World Bank Abstract: China in the past few years has ... express net foreign assets as a share of wealth, and average over all available annual observations between 1980 and 2000 to construct a single cross-section of 20-year averages In Table 2 we first ... seen that China is a strong outlier in the relationship between capital stocks per capita and net foreign assets in Figure 5, and empirically per capita capital stocks and per capita wealth are

Ngày tải lên: 29/08/2016, 08:08

47 79 0
DSpace at VNU: A beta 41 Aggregates More Like A beta 40 than Like A beta 42: In Silico and in Vitro Study

DSpace at VNU: A beta 41 Aggregates More Like A beta 40 than Like A beta 42: In Silico and in Vitro Study

... difference of aggregation rate between Aβ1-40 and Aβ1-41 is less than that of Aβ1-42 Taken together, our results indicate that the aggregation rate for Aβ1-42 is faster than that for Aβ1-40 and Aβ1-41 ... increased fibril formation rates and consequently neurotoxicity of Aβ peptides Trang 4,Aβ4-42 and Aβ5-423 are also found inside amyloid plaques Variants longer than Aβ1-42 such as Aβ1-43, Aβ1-45, ... molecular weight Aβ1-40 aggregates gives 88% of random coil and turn, 12% of β-strand and 0% of α-helix at pH 7.5, 295 K, and day 038 Trang 14another preparation of Aβ1-40 aggregates gives a β-strand

Ngày tải lên: 12/12/2017, 10:09

44 106 0
Elevated tumor necrosis factor-a-induced protein 8-like 2 mRNA from peripheral blood mononuclear cells in patients with acute ischemic stroke

Elevated tumor necrosis factor-a-induced protein 8-like 2 mRNA from peripheral blood mononuclear cells in patients with acute ischemic stroke

... Forward CTCAGCAACTTCAACCCG Reverse GCACTTGGAGGCAGCCCG NF-kB Forward CACAGATACCACTAAGACGCACC Reverse GACCGCATTCAAGTCATAGTCC IL-6 Forward ACCCCTGACCCAACCACAAAT Reverse AGCTGCGCAGAATGAGATGAGTT ... Forward ATGCTTCGAGATCTCCGAGA Reverse AAATCGATGACAGCGCCGTA IL-1β Forward AAACAGATGAAGTGCTCCTTCCAGG Reverse TGGAGAACACCACTTGTTGCTCCA β-actin Forward ATGGGTCAGAAGGATTCCTATGTG Reverse CTTCATGAGGTAGTCAGTCAGGTC ... Forward GGAACATCCAAGGCAAGACTG Reverse AGCACCTCACTGCTTGTCTCATC TNF-α Forward AAGCCTGTAGCCCATGTTGT Reverse CAGATAGATGGGCTCATACC IFN-γ Forward GCAGAGCCAAATTGTCTCCT Reverse ATGCTCTTCGACCTCGAAAC AP-1

Ngày tải lên: 15/01/2020, 04:08

10 43 0
Anti-vascular effects of the cytosolic phospholipase A2 inhibitor AVX235 in a patient-derived basal-like breast cancer model

Anti-vascular effects of the cytosolic phospholipase A2 inhibitor AVX235 in a patient-derived basal-like breast cancer model

... endothelial cell proliferation and vessel maturity, respectively Partial least squares discriminant analysis was performed on the multivariate HR MAS MRS data, and non-parametric univariate analyses ... therapies for triple-negative basal-like breast cancer Abbreviations AA: arachidonic acid; AUC1min: initial area under the curve during first minute after contrast injection; BLBC: basal-like ... vasculature is characteristically abnormal, with irregular, disorganized, and leaky vessels Anti-angiogenic therapies have been shown to induce a temporary normalization of tumor vasculature with an

Ngày tải lên: 21/09/2020, 09:17

11 14 0
slide 1 answer the questions about hoa what time do her classes start and finish how many hours a day does she do her homework what does she often do in the summer holiday her classes start at 7 an

slide 1 answer the questions about hoa what time do her classes start and finish how many hours a day does she do her homework what does she often do in the summer holiday her classes start at 7 an

... the letter BACK Trang 21BACKTrang 22How many vacations do American students have?They have 6 vacations. BACK Trang 23What are the vacations?They’re summer vacation, New Year, Easter, 4th of July ... is an American student. 3.American students have 5 vacations 4.They have Tet holiday, too. Trang 181.Hoa receives a letter from Liz.2.American students have 5 vacations. 3 Tim is an American ... classes start at 7 and finish at 11.15.2.She does her homework about 2 hours a day. 3.In the summer vacation, she goes and see her Mom and Dad on the farm. Trang 5How many vacations do American

Ngày tải lên: 20/04/2021, 06:00

33 31 0
Testing is intended to show that a program does what it is intended to do and to dis

Testing is intended to show that a program does what it is intended to do and to dis

... U1 (a,b) = (b,a) U2 (a,0) = a (qui ướ ) U3 (a,b) = (a mod b, b): ước chung lớn nhất của hai số không thay đổi nếu ta thay một trong hai số bằng số dư của số đó chia cho số kia U4 (a,b) = a ... Set(a, b) l tập s nguy n trong khoảng a ến b, ụ thể Trang 13q = a / b r = a mod b T thấy a l ướ b khi v hỉ khi b mod a = 0 Nếu a kh ng phải l ướ b t viết a | b T ng qui ướ thương a / ... v Robinson tính to n tr n m y tính Western US National Bureau of Standards (SWAC) tại Instute for Numeri l An lysis thuộ Đại họ C liforni , Los Angeles Đó l s nguy n t Mersenne ượ ph t hiện s

Ngày tải lên: 09/04/2022, 20:25

92 8 0
Listen a minute com   ESL listening   accidents

Listen a minute com ESL listening accidents

... hospital Traffic accidents are the worst They’re always alpfiun I haven’t had too many work-related accidents I spsoeup that’s because I do office work and that’s not so dsgoeuarn Most of my accidents ... hospital Traffic accidents are the worst They’re always painful I haven’t had too many work-related accidents I suppose that’s because I do office work and that’s not so dangerous Most of my accidents ... Traffic accidents are the worst They’re always painful I haven’t had too many work-related accidents I suppose that’s work do because office I and that’s not so dangerous Most of my accidents are

Ngày tải lên: 23/04/2022, 15:14

10 43 0
What would a transdisciplinary university look like

What would a transdisciplinary university look like

... reliable and precise; those that fail to do so are regarded as speculative and unreliable When this occurs, humanistic and philosophical inquiry takes on secondary status Philosophical claims ... the transdisciplinary spirit fosters a continuously awareness that the objects of our inquiries are always part of a larger whole that must be acknowledged and understood As a result, it calls ... tools available to understand the complex relations among the biophysical, psychological and socio-cultural dimension of our world (Cannizzaro, 2014; Capra & Luisi, 2016; Kaufman, 1993; Troncale,

Ngày tải lên: 12/10/2022, 08:53

25 3 0
Mir-302 reprograms human skin cancer cells into a pluripotent ES-cell-like state Supporting Online Materials

Mir-302 reprograms human skin cancer cells into a pluripotent ES-cell-like state Supporting Online Materials

... CAATATCTTA ATCCTGTCCC TTTTTTTTCC ACAGTAGGAC CTTCGTGCA-3’ and antisense 5’-TGCACGAAGG TCCTACTGTG GAAAAAAAAG GGACAGGATT AAGATATTGA TAGTTAGTAA TGACGCGTCG CGACGATCGG ACCACTTAC-3’ (Sigma-Genosys, ... (1:500, Abcam Inc., Cambridge, MA), ABCA2 (1:100, Santa Cruz Biotechnology, Santa Cruz, CA), Dazla (1:100, Abcam), EE2 (1:100, Santa Cruz), atlastin1 (1:200, Santa Cruz), COL1A1 (1:500, Santa Cruz), ... products were fractionated on a 2% agarose gel, and a ~900 base-pair (bp) sequence was extracted and purified by a gel extraction kit (Qiagen, Valencia, CA), following the manufacturer’s suggestion

Ngày tải lên: 20/10/2022, 02:42

11 2 0
convergence analysis of a three step newton like method for nonlinear equations in banach space under weak conditions

convergence analysis of a three step newton like method for nonlinear equations in banach space under weak conditions

... Sciences, Cameron University Lawton, OK 73505, USA E-mail: iargyros@cameron.edu Trang 10Santhosh GeorgeDepartment of Mathematical and Computational Sciences NIT Karnataka India-575 025 E-mail: sgeorge@nitk.ac.in ... Trang 1Seria Matematic˘a – Informatic˘a LIV, 2, (2016), 37– 46 Convergence Analysis of a Three Step Newton-like Method for Nonlinear Equations in Banach Space under Weak Conditions Ioannis K Argyros ... continuation process for solving systems of non-linear equations Ed by A.N.Tikhonov et al in Mathematical models and numerical methods, Banach Center, Warsaw Poland, 1977, 129-142 [14] J.R Sharma and

Ngày tải lên: 24/11/2022, 17:38

10 3 0
What should a good interpreter be like be like

What should a good interpreter be like be like

... professional interpreters is ingreater and greater demand Actually, interpreters today aresmall in quantity, and their quality is a burning issue as well.The reason lies in the fact that interpretation ... only asmall number of students take interpretation as their major,and the number of the graduates doing the interpretation job ismuch smaller A graduate of interpretation and translationmajor ... her language? (Cited from Luong, T.L et al., 16) In addition, the Vietnamese Ambassador Vo, A.T (2000,48) also agrees that interpreters play a very crucial role ininternational negotiations and

Ngày tải lên: 01/09/2023, 21:57

62 3 0
Ebook -  How to Act like a CEO

Ebook - How to Act like a CEO

... road map to follow when evaluating someone,”says Lawrence Land, attorney-at-law Talk about legacy! “I’d rather have a ‘handshake deal’ with a son of integrity, than a forty page document with a ... 0-07-135998-2 All trademarks are trademarks of their respective owners Rather than put a trademark symbol after every occurrence of a trademarked name, we use names in an editorial fashion only, and to ... constantly influence and persuade, be a part of a community,and sustain some balance for personal sanity In terms of profes-sional and personal application those key areas make up the chap-ters in this

Ngày tải lên: 29/12/2013, 21:06

224 468 0
Cook Like a Pro

Cook Like a Pro

... which makes it easier to unmold the tart e TARTLET PANS Small metal pans are used to make individual tarts, cakes, and other sweet and savory baked goods Like tart pans, these are available with ... Sauce All-Purpose Pan Gravy Bechamel Sauce with flavor embellishments Beurre Blanc with variations Hollandaise Sauce with variations Mayonnaise with flavoring options Basic Vinaigrette with variations ... melted and tiny bubbles have formed along the edges of the pan 6 Use or cool the ganache Use the ganache right away as a sauce for ice cream, a shiny glaze for a cake, or a filling for a tart Or,

Ngày tải lên: 15/01/2014, 12:17

25 357 0
Tài liệu How to Think Like a Computer Scientist pptx

Tài liệu How to Think Like a Computer Scientist pptx

... computer programs Allprogramming languages are formal languages pur-natural language: Any of the languages people speak that have evolved urally nat-portability: A property of a program that can run ... read the program and locate syntaxerrors One of the most powerful features of a programming language is the ability to manipulate variables A variable is a named location that stores a value.Values ... remember that the details matter Little things likespelling errors and bad punctuation, which you can get away with in naturallanguages, can make a big difference in a formal language Traditionally

Ngày tải lên: 19/01/2014, 16:20

298 532 0
Tài liệu The 60 Minute Network Security Guide (First Steps Towards a Secure Network Environment) ppt

Tài liệu The 60 Minute Network Security Guide (First Steps Towards a Secure Network Environment) ppt

... had the effect of increasing the attack surface available to an adversary an avenue that was taken advantage of in various Internet based attacks This section offers security configuration ... dictionary words, hybrids, names, and default passwords. Additionally passwords less than 8 characters and passwords that are the same as the username are also frequently used. These types of passwords ... being able to take advantage of them. An application may install sample CGI scripts or other applications, which sometimes contain problems. As a general rule do not install sample applications

Ngày tải lên: 14/02/2014, 08:20

48 598 1
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... Trang 1activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa ... ervatamin-A (Ala67fi Tyr) results in a 57-fold increase in its kcat⁄ Km value for a substrate having a Val at the P2 position Our studies indicate a higher enzymatic activity of ervatamin-A, which ... signaling cascades of plants [1] These proteases belong to the C1 family, clan CA according to the classification in the merops database (http://merops.sanger.ac.uk); this also contains mammalian

Ngày tải lên: 18/02/2014, 16:20

14 636 0
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx

Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx

... N-terminal pro domain is autocatalytically cleaved off when the enzyme has obtained its active conforma-tion, and the two C-terminal domains are cleaved off by heat treatment at 50C An Ala-Pro-Thr ... Neutral pep-tidases are active within a relatively narrow range (pH 5–8) and are often used in the food industry Alkaline peptidases are generally highly active around pH 10, have broad substrate ... Func-tional Genomics Programme (FUGE) in The Research Council of Norway and Biotec Pharmacon ASA References 1 Rao MB, Tanksale AM, Ghatge MS & Deshpande VV (1998) Molecular and biotechnological aspects

Ngày tải lên: 19/02/2014, 07:20

11 553 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-GACACCGTAGGTTGAGCCGCCAATC CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢) Nested PCR was ... 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢) and downstream primer (NP7: 5¢-CAATCTCCATGGCTAG TAGCTTGCACTCAG-3¢) containing a NcoI ... exo- peptidases are widespread in nature and found in viruses, archaea, bacteria and euk-aryotes The biological importance of peptidases are clearly indicated by the fact that 2% of all genes

Ngày tải lên: 19/02/2014, 07:20

14 525 0
Tài liệu A DINING EXPERIENCE LIKE NO OTHER! PLANET HOLLYWOOD ppt

Tài liệu A DINING EXPERIENCE LIKE NO OTHER! PLANET HOLLYWOOD ppt

... beefASIAN Trang 7LA LASAGNA £12.50A californian twist to classic lasagna! Fresh pasta tubes filled with ricotta cheese and bolognese meat sauce, fried to a golden brown and covered with a garlic ... and mixed salad leaves tossed in a lime cilantro and peanut vinaigrette TOMATO AND MOZZARELLA CAPRESE (V) £9.95 Vine ripened tomatoes with fresh mozzarella, basil oil and aged balsamic vinegar ... pineapple juice and lemonade THE BIG BOY Giant cocktail to share - £20.00 - ask your server for details VINTAGE COCKTAILS Trang 24Sagatiba cachaca, lime quarters and sugar Brazil’s national drink!

Ngày tải lên: 19/02/2014, 14:20

28 467 0
Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

... antisense: 5¢-AGATGCGGCCGCTTAATTCTCCC TCAAGATCTTATTGATCC-3¢ for rMCP-5, and sense: 5¢-GACTGAATTCATGCATCTTCTTGCTCTTCAT-3¢ (A) and antisense 5¢-GACTGCGGCCGCTTAATTCTC CCTCAAGATCTTATTG-3¢ (B) for ... method of Ho et al [31] The cDNA of the V216G mutant of mMCP-5 was generated by recombinant PCR using a mutagenic primer pair (sense: 5¢-CAAGGCATTGCATC CTATGGACATCGGAATGCAAAGCCC-3¢, and antisense: ... mMCP-5 was obtained from the SWISSPROT [32] database A homology search of the Protein Data Bank was carried out by using the FASTA and BLAST programs, and human chymase, rat mast cell protease (rMCP)-2,...

Ngày tải lên: 08/03/2014, 09:20

10 384 0
w