viewing printing a previously saved activity report archive

Báo cáo khoa học: "Lack of Cetuximab induced skin toxicity in a previously irradiated field: case report and review of the literature" pdf

Báo cáo khoa học: "Lack of Cetuximab induced skin toxicity in a previously irradiated field: case report and review of the literature" pdf

... erythema and dry skin remain in areas previously dominated by the papulopustular eruption [9] Here, we report a case of lack of Cetuximab-induced skin rash in an area that had previously been irradiated ... ear This was initially excised and treated with adjuvant radiation treatment using 12 MeV electrons between January and March 2008 An initial dose of 50 Gy was delivered to the external ear and ... previously been irradiated for SCC and present a brief review of the literature Case Report A 78-year-old Caucasian male was diagnosed with a well differentiated squamous cell carcinoma (SCC) of the...

Ngày tải lên: 09/08/2014, 08:23

4 254 0
Báo cáo khoa hoc:" Ecthyma gangrenosum without bacteremia in a previously healthy man: a case report" potx

Báo cáo khoa hoc:" Ecthyma gangrenosum without bacteremia in a previously healthy man: a case report" potx

... and A participated in patient management and diagnosis AE made the pathological examination and diagnosis All authors read and approved the final manuscript Publish with Bio Med Central and every ... direct bacterial invasion of the media and adventitia of the vascular walls, but not the intima [2] In general, acute mixed inflammatory cell infiltration and vascular proliferation are seen ... trauma Early diagnosis and aggressive therapy are important in the management of ecthyma gangrenosum An antipseu- Page of (page number not for citation purposes) Journal of Medical Case Reports...

Ngày tải lên: 11/08/2014, 10:23

3 100 0
Báo cáo y học: " Late-onset erythromelalgia in a previously healthy young woman: a case report and review of the literature" doc

Báo cáo y học: " Late-onset erythromelalgia in a previously healthy young woman: a case report and review of the literature" doc

... pituitary magnetic resonance imaging (MRI) were normal The autoimmune panel was normal including negative antiperoxidase, antiadrenal, anti-ovarian, gastric parietal, antinuclear, antiSmith, and anti-DNA ... tolerate any change in environment that exposes her to warm air Our patient's case has additional unusual features Her pattern of involvement is mainly the upper chest, neck, face and head area, as ... Surgical sympathectomy has had variable results Treatment with medications such as gabapentin, SSRIs, TCAs, and CCBs has had some symptomatic benefits in a few cases One case study [14] reported...

Ngày tải lên: 11/08/2014, 17:21

4 208 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... tuberculate, supplemental and odontome; however, the Literature also reports a classification according to intraoral position of the supernumerary teeth: Mesiodens; Paramolar; Distomolar and Parapremolar ... patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic...

Ngày tải lên: 25/10/2012, 11:40

7 598 0
A Group Introduction Activity to Create a Safe Atmosphere

A Group Introduction Activity to Create a Safe Atmosphere

... brother, and her two cats, Mina and Tom Nozomi: This is Izumi She's from Yokohama, but now lives in the student dorm on campus She has a roommate from Canada, and is happy to have a chance to practice ... important to me as a teacher that the class become a unified whole, in which each student feels capable of speaking, capable of saying something valuable, feels that others will support them, and ... ensure that the class is involved in the introductions Each activity is designed to create a safe atmosphere, in which each student has a stake in the successful completion of each oral assignment...

Ngày tải lên: 06/09/2013, 10:10

4 386 0
Printing a Pivot Table

Printing a Pivot Table

... options are turned on, so headings and labels appear on each page Figure 11-6 The Category and Customer labels repeat at the top of page two 11.8 Using Report Manager: Printing Pivot Table Data Problem ... provides an Excel add-in, Report Manager, that you can use to create and print reports from worksheets, custom views, and scenarios The download file and installation instructions are available on ... Solution You can change a pivot table option so the labels appear on each page: 229 6293ch11.qxd 230 2/1/06 2:34 PM Page 230 11.8 ■ USING REPORT MANAGER: PRINTING PIVOT TABLE DATA Right-click a cell...

Ngày tải lên: 21/10/2013, 22:20

12 492 0
Tài liệu A.5. The Clean Install ("Archive and Install") pdf

Tài liệu A.5. The Clean Install ("Archive and Install") pdf

... time (if you run it as a Web server, for example), it's a good idea to use the journaled hard drive format Keep in mind, too, that blackouts affect your hard drive just as much as pulling the plug ... repair It has to scan the whole drive–which can take anywhere from a couple of minutes (if your hard drive is less than 10 GB) to a couple of hours (if your hard drive is more than 200 GB) Thanks ... doesn't actually recover what you were working on when your Mac shut down; it can only try to keep files you already saved from getting corrupted Second, file journaling can make it take slightly...

Ngày tải lên: 14/12/2013, 12:15

2 422 0
Tài liệu Defending Economic and Social Rights in Cambodia A High-Risk Activity pdf

Tài liệu Defending Economic and Social Rights in Cambodia A High-Risk Activity pdf

... and to freedom of assembly are guaranteed under Cambodian law, as well as under various international instruments that impose formal legal obligations on Cambodia as a State Party to the treaties ... Germany Mr Laurent Le Marchand First Secretary Embassy of the French Republic Ms Donica Pottie Ambassador Canada Mr David Reader Ambassador British Embassy Civil society Mr An Nan Investigator ... Observatory recalls that the UN Special Representative of the Secretary General for Human Rights in Cambodia had already expressed deep concern “that in Cambodia defamation and disinformation are...

Ngày tải lên: 20/02/2014, 19:20

32 433 0
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot

Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot

... measured at room temperature ROA data originating in artefacts from bu€er bands have been cut out in some places Fig The backscattered Raman and ROA spectra of recombinant human wild-type tau46 ... The j-casein was prepared by adaptation of two other methods, each of which employs an acid precipitation stage to isolate the whole casein, a calcium precipitation stage to partially separate the ... polarization of the incident argonion laser beam between right- and left-circular at a suitable rate The spectra are displayed in analog-to-digital counter units as a function of Stokes wavenumber...

Ngày tải lên: 21/02/2014, 15:20

9 670 0
FURNITURE AND FIXTURES: A GLOBAL STRATEGIC BUSINESS REPORT potx

FURNITURE AND FIXTURES: A GLOBAL STRATEGIC BUSINESS REPORT potx

... Poland, Indonesia, Romania, China, Czech Republic, Malaysia, Brazil, Vietnam, Taiwan, Switzerland, Hungary, Norway, Thailand, Slovenia, South Africa, USA, Estonia, Lithuania, India, and Slovakia ... ‘000) by Country – Canada, Mexico, United Kingdom, Japan, Saudi Arabia, Korea, Germany, China, Kuwait, Italy, Australia, Jamaica, Bahamas, Hong Kong, UAE, and Others III-6 Table 40: Household ... Institutional Furniture and Fixtures by Geographic Region – USA, Canada, Japan, Europe, Asia-Pacific (excluding Japan), Middle East, and Latin America Markets Independently Analyzed with Annual Sales...

Ngày tải lên: 06/03/2014, 23:20

38 447 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

... ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA CAGCAACGCAAGCTT CAGCAACGCAAGCT CAGCAACGCAAG AGAGATTTTCCACAT CTAGAGATTTTCCACAT TGCTAGAGATTTTCCACAT TGACAAGGATGGCTGGTGGGACTTAGCGTA ... TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT GTCCTAGCAAAGCGTATGTGATCACTGG GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC ... TGCTGTCTAGAGACTATCGC GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC GGACATCTTTGCCCACGTTGACCCG ATCTTTGCCCACGTTGACCCG TTGCCCACGTTGACCCG GCGATAGTCTCTAGACAGCATGTCC of the archaeal FEN-1 homologues have assisted...

Ngày tải lên: 07/03/2014, 10:20

14 434 0
Báo cáo khoa học: An unusual plant triterpene synthase with predominant a-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus · domestica ppt

Báo cáo khoa học: An unusual plant triterpene synthase with predominant a-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus · domestica ppt

... 5¢-CTCTCTTAGTATCTGAAAACGCCATAGG AG-3¢; MdOSC2 forward, 5¢-CGCAGATGGTGGCAATG ATCCATACATC-3¢; MdOSC2 reverse, 5¢-TGAAGTTCT TCTCCCTTAAGAACTGCATTC-3¢; MdOSC3 forward, 5¢-GCAATCGTGATCAAAGAAGATGTGGAGG-3¢; and MdOSC3 ... Pisum sativum 100 MtAMY1 Medicago truncatula AT1G78955 (CAMS1) Arabidopsis thaliana C/Ach/β 84 AT1G78950 (AtBAS) Arabidopsis thaliana 26 AT1G78970 (LUP1) Arabidopsis thaliana L/β 96 AT1G66960 Arabidopsis ... Rhizophora stylosa T/β/L AT4G15370 (BARS1) Arabidopsis thaliana AT4G15340 (ATPEN1) Arabidopsis thaliana 99 35 AT5G48010 (THA1) Arabidopsis thaliana AT5G36150 Arabidopsis thaliana

Ngày tải lên: 14/03/2014, 23:20

15 470 0
A christmas carol activity book

A christmas carol activity book

... that Christmas was a humbug,’ cried Ebenezer’s nephew Ebenezer’s nephew cried that uncle Scrooge that Christmas was a humbug a) would say b) had said c) has said d) said ‘He has always been a ... generosity after a while partially O T G T Across: The ghost was making very noises People say that in a haunted house spirits are in the air A person has a but a ghost doesn’t because it is transparent ... a) appears b) must c) is d) would The ghost because of his past a) is trapped b) was being trapped c) traps d) was trapping Marley always a good man of business a) was being b) is c) was...

Ngày tải lên: 20/03/2014, 15:52

25 874 1
A Survey of Activity Network-Based Process Models for Managing Product Development Projects doc

A Survey of Activity Network-Based Process Models for Managing Product Development Projects doc

... (McManus 2004) While similar to traditional flowcharting in many respects, value stream mapping adds emphasis on activity attributes such as cycle time, duration, and value-added Sabbaghian, Eppinger, ... as standard processes become more widely used as a basis for project planning and organizational learning, research on tailoring and scaling a standard process for a particular project takes ... selects the appropriate version of an activity and a postevaluation step determines if iteration is needed Similarly, Chung, Kwon, and Pentland (2002) advocate a “grammatical approach”7 to process...

Ngày tải lên: 23/03/2014, 04:20

24 461 0
Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf

Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf

... greater catalytic efficiency as a reductase than as a dehydrogenase The catalytic efficiency of RDH13 as a retinaldehyde reductase is significantly lower than that of a related protein RDH11, primarily ... incubated at 28 °C for 3–4 days The mitochondrial fraction was isolated as described above, and then solubilized with 15 mm DHPC (Avanti Polar Lipids, Alabaster, AL, USA) in a buffer containing ... production Rabbit polyclonal antiserum against purified RDH13–His6 was raised at Alpha Diagnostics International Inc (San Antonio, TX, USA) 144 For western blot analysis of RDH13 expression, samples...

Ngày tải lên: 23/03/2014, 07:20

10 678 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

... the same conditions as reported [34] Determination of amino-acid sequence and MS analysis The full amino-acid sequence of the toxin was obtained by direct Edman degradation, using an automatic ... Fig Final purification and amino-acid sequence determination of Cn12 (A) A sample of fraction II-4 from a CM-cellulose ionexchange column [33] containing mg protein was applied to an analytical C18 ... obtain the inactivation time constants pClamp (Axon Instruments) and Origin 4.1 (Microcal Inc, Studio City, CA, USA) software were routinely used during data acquisition and analysis Preparation of...

Ngày tải lên: 23/03/2014, 12:20

13 435 0
Strategies for Project Recovery» A PM SOLUTIONS RESEARCH REPORT ppt

Strategies for Project Recovery» A PM SOLUTIONS RESEARCH REPORT ppt

... surveyed not have a standard project management methodology for managing their projects » Small firms were the least likely to have a standard methodology (30% had no PM methodology); large firms ... problematic technical issues Replace the project manager or bring in a consultant to manage the recovery Project Recovery Although it is usually senior management that makes the decision to actively ... than half as many issues, and replacing the project manager project failures as those that did not have » The project manager is a key success factor in the one recovery of projects Almost all firms...

Ngày tải lên: 29/03/2014, 23:20

8 333 0
Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

... bronchial asthmatic patients [10] These observations suggest that HAT might mediate airway inflammation by PAR-2 activation In addition to airway inflammation, hypersecretion of airway mucus is a characteristic ... were analysed on a FACS Calibur cytometer (BD Bioscience, Mountain View, CA, USA) Statistical analysis Data are presented as the mean ± SD of at least three separate experiments For statistical analysis, ... through ERK activation; (b) at least a part of HAT-induced initial ERK activation is mediated through PAR-2; (c) only HAT, and not PAR-2 AP, causes AR protein release through TACE activity; and (d)...

Ngày tải lên: 30/03/2014, 11:20

13 243 0
Response of the Affected Agency Comments on Agency Response We transmitted a draft of this report potx

Response of the Affected Agency Comments on Agency Response We transmitted a draft of this report potx

... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ...

Ngày tải lên: 18/06/2014, 20:20

5 159 0
Báo cáo toán học: " A novel voice activity detection based on phoneme recognition using statistical model" pdf

Báo cáo toán học: " A novel voice activity detection based on phoneme recognition using statistical model" pdf

... linear predictive coding parameters, energy, formant shape, zero crossing rate, autocorrelation, cepstral features and periodicity measures [7–12] For example, Fukuda et al [11] replaced the traditional ... with all noises observed in the real world Recently, the statistical model based VAD approach is considered an attractive approach for noisy speech Sohn et al [13] proposed a robust VAD algorithm ... respectively have advantages and disadvantages against different noises We combine the advantages of these two methods together for making the VAD algorithm more robust The method proposed in this article...

Ngày tải lên: 20/06/2014, 20:20

28 477 0
w