... permission DOCTORAL EXAMINATION AND DISSERTATION REPORT Candidate: Ling Chao Chen Major Field: Music Title of Dissertation: An Analysis of Witold Lutoslawski's "Variations on a Theme by Paganini" ... Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1996 An Analysis of Witold Lutoslawski's "Variations on a Theme by Paganini" for Two Pianos and ... two parts Part I is an analysis of Witold Lutoslawski's "Variations on a Theme by Paganini" for Two Pianos This consists of a detailed analysis preceded by a brief introductory discussion of
Ngày tải lên: 01/11/2022, 23:21
... exactly as in the particular case θ = 1 We still have a canonical isomorphism of graded algebras gr(Aθ) ≃ Λ and a canonical isomorphism of filtered algebras A ≃ Λ∗ θ, where Λ∗ θ denotes the algebra ... but can be made completely self-contained In particular, no information on Jack polynomials is required The argument is based on a remarkable idea due to S Kerov [5] and some considerations from ... characterization of the algebra A is given in Section 6 Trang 53 A proof of Theorem 1.1The Young graph has Y as the vertex set, and the edges are formed by couples of diagrams that differ by a
Ngày tải lên: 08/08/2014, 12:22
A STUDY ON LANGUAGE USED BY FLIGHT ATTENDANTS
... (but not always beyond the realm that English language teachers are comfortable teaching – unless they have an aviation background or a deep interest in aviation In contrast the term Aviation English ... always have available and make use of lots of differently sourced materials and training aids, as thousands are available Indeed, a key factor in language learning is that the learners have access ... flight attendants might also be asked to make public relations appearances for their corporation at career days held by high schools or at fundraising campaigns, sales meetings, conventions, and
Ngày tải lên: 11/12/2013, 23:52
Báo cáo hóa học: " Research Article Static Object Detection Based on a Dual Background Model and a Finite-State Machine Rub´ n Heras Evangelio and Thomas Sikora e" doc
... modelled as a mixture of a maximum number N of Gaussians Each Gaussian distribution i is characterized by an estimated mixing weight ωi , a mean value, and a variance The Gaussian distributions are ... (states) and establish which transitions are allowed from each state and what are the inputs needed to cause these transitions In this way, we can define the state transitions of a finitestate machine, ... distribution are updated according to a learning rate α as expressed in [16] If not, a new one is generated with mean value equal to the pixel value and weight and variance set to some fixed initialization
Ngày tải lên: 21/06/2014, 07:20
The Hands-On Guide for Science Communicators: A Step-by-Step Approach to Public Outreach potx
... game In summary, astronomy can lead the way for other natural sciences and be a frontrunner in science communication Astronomy has a na tural ability to fascinate and enthral, and can open young ... change relatively often and are also subject to signifi cant geographic and national variations that make the task of generalising diffi cult Other books treat education in great detail, such as, ... language Values near certain information Uses facts, but also more speculative indications to give perspective Values indications Values quantitative information Balances facts with emotional
Ngày tải lên: 27/06/2014, 05:20
A Treatise on Grain Stacking, by John DeLamater docx
... FOUNDATION. If convenient, make a foundation of rails, by placing three rails about four and one- half feet apart and parallel, and then add half or two thirds the Trang 13length of a rail to each, ... LAMATER. Trang 9So far as I am aware, this is an untried field of labor—a pioneer work which I have had under consideration for the last fifteen years; during which time the closest attention ... below, leaving a space for rainto drive in and wet the stack Draw in outside course rapidly; lay buts of second course half way from head to band on outside course as long as stack top is large enough;
Ngày tải lên: 28/06/2014, 19:20
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx
... Trang 1A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element MethodMsc Cao Tan Ngoc Than* ** Graduate School, Cheju National University, Cheju, Korea, 690 756 -Speaker ... Boundary ConditionsFree surface condition: Definition of two vertical circular cylinders (N=2) Trang 10N mS n I S , 1 , on R on 0 } { lim Cylinder surface condition: Radiation boundary condition: ... two tandem cylinders for ka 1.0 Free-Surface Elevation Trang 27Wave height distribution around three cylinders in triangular array for0.1 ka incident wav Trang 28IV Conclusions and Remarks
Ngày tải lên: 26/07/2014, 07:20
Báo cáo toán học: "A Mathematical Bibliography of Signed and Gain Graphs and Allied Areas Compiled by Thomas Zaslavsky Manuscript prepared with Marge Pratt" pdf
... gain graph [See also Harary, B.D Acharya, M.K Gill, and G.A Patwardhan 1984a Quasicospectral graphs and digraphs In: Proceedings of the National Symposium on Mathematical Modelling (Allahabad, ... (1968a)(q.v.), Bang-Jensen and Gutin (1998a), Das and Rao (1983a), Grossman andH¨aggqvist (1983a), Mahadev and Peled (1995a), Saad (1996a).] M B´ ankfalvi and Zs B´ ankfalvi 1968a Alternating Hamiltonian ... Trang 1Signed and Gain Graphs and Allied AreasCompiled byThomas ZaslavskyManuscript prepared with Marge Pratt Department of Mathematical Sciences Binghamton UniversityBinghamton, New York,
Ngày tải lên: 07/08/2014, 05:23
Báo cáo khoa học: "The decline of a Pinus nigra Arn. reforestation stand on a limestone substrate: the role of nutritional factors examined by means of foliar diagnosis" doc
... DW/Area) All data are expressed as mean values, stan-dard deviation and correlations; a variance analysis with ANOVA-LSD test and discrim-inant analysis were further performed The software ... weight, as well as a marked antagonism to manganese The influence of the nearby metropolitan area of Florence is suggested by the accumulation of lead. (© Inra/Elsevier, Paris) afforestation ... hydrogeological stability in areas with difficult pedoclimatic conditions which were covered by secondary meadows or by degraded broadleaf woods Today, the artificial stands cover an area greater than
Ngày tải lên: 08/08/2014, 23:22
Lecture notes on linear algebra by a k lal and s pati
... entries a11, a22, , annof an n×n square matrix A = [aij] are called the diagonalentries (the principal diagonal) of A 4 A square matrix A = [aij] is said to be a diagonal matrix if aij = 0 ... Definition of a Matrix Definition 1.1.1 (Matrix) A rectangular array of numbers is called a matrix The horizontal arrays of a matrix are called its rows and the vertical arrays are calledits ... words, the non-zero entries appear only on the principal diagonal For example,the zero matrix 0n and " 4 0 0 1 #are a few diagonal matrices A diagonal matrix D of order n with the diagonal entries
Ngày tải lên: 24/08/2016, 12:26
WHO Annex 6 Guidance on variations to a prequalifi ed product dossier TRS943 annex6
... 2 Comparative table of prequalifi ed and proposed specifi cations 3 Details of any new analytical method and validation data 4 Batch analysis data (in a comparative tabular format) on a minimum ... the International Conference on Harmonisation (ICH) region and associated countries 2 Site appropriately authorized by a DRA (to manufacture the pharmaceutical form and the product concerned) ... characterization and the determination of its quality Finished pharmaceutical product (FPP) The acronym FPP always represents a pharmaceutical product after fi nal release (manufacturing control
Ngày tải lên: 04/12/2017, 04:45
DSpace at VNU: On a technique for deriving the explicit secular equation of Rayleigh waves in an orthotropic half-space coated by an orthotropic layer
... investigation of Rayleigh waves propagating in elastic half-spaces covered by an elastic layer The secular equation of Rayleigh propagating in an orthotropic half-space coated by an orthotropic layer has ... quantities related to the half-space and the layer have the same symbol but are systematically distinguished by a bar if pertaining to the layer Consider the propagation of a Rayleigh wave traveling ... −iω¯u2are the components of the particle velocity From (21) it implies A24= A13, A33= A22, A34= A12, A42= A31, A43= A21, A44= A11 (24) where A ijare components of the transfer matrix A These relations
Ngày tải lên: 12/12/2017, 07:54
DSpace at VNU: A Simple Approach to the Fabrication of Graphene-Carbon Nanotube Hybrid Films on Copper Substrate by Chemical Vapor Deposition
... electrical, mechanical and optical properties, graphene with two-dimensional (2D) carbon nanostructure has emerged as a new class of promising materials attractive for various applications, such as ... disclaimers that apply to the journal pertain ACCEPTED MANUSCRIPT A Simple Approach to the Fabrication of Graphene-Carbon Nanotube Hybrid Films on Copper Substrate by Chemical Vapor Deposition ... Accepted Manuscript A Simple Approach to the Fabrication of Graphene-Carbon Nanotube Hybrid Films on Copper Substrate by Chemical Vapor Deposition Nguyen Van Chuc, Cao Thi Thanh, Nguyen Van
Ngày tải lên: 16/12/2017, 04:56
A VIETNAMESE AMERICAN CROSS CULTURAL STUDY OF GIVING COMMENTS ON CONTESTANTS’ PERFORMANCE BY JUDGES IN VIETNAM IDOL AND AMERICAN IDOL
... shared and specific meanings that are communicated Language and communication are always changing along with the change of society because communication is considered as a process in which meanings ... process of measurement is central to quantitative research because it provides the fundamental connection between empirical observation and mathematical expression of quantitative relationships Besides, ... informants (one female and two males), but in the final round, one informant is added The second group was judges (also one female and two males) Details of the informants’ parameters are: - Vietnamese
Ngày tải lên: 08/09/2018, 22:48
Packt ruby on rails web mashup projects a step by step tutorial to building web mashups apr 2008 ISBN 1847193935 pdf
... Registering as an Amazon Associate 82 Trang 11Creating a shopping cart 97Creating a Rails application 114 Creating a Facebook application 114 Installing and configuring RFacebook 115 Extracting the Facebook ... Significant innovation can be achieved with further aggregation and hybridization of code and data from publicly available APIs, with private data as well as private applications Trang 22The idea behind ... database that we will be using Configuring database access and creating the database Assuming that you already know how database migration works in Rails, generate a migration using the migration
Ngày tải lên: 20/03/2019, 14:24
Realizing awakened consciousness interviews with buddhist teachers and a new perspective on the mind by richard boyle
... three majorpractice traditions—Zen, Tibetan Vajrayana practice, and vipassana or mindfulness—Zenand Vajrayana are highly modified for a specific cultural niche, East Asia in the former caseand Indo-Tibetan ... inthe Harada-Yasutani tradition of Japanese Zen, from whom he received Dharmatransmission During a sesshin with Seung Sahn in a borrowed martial arts dojo on Long Island, he had an important early ... notingtechnique associated with Theravada Buddhism, and I emphasize a strong ethicalparadigm, also based on the Theravada tradition That’s what I now teach The other thing Idiscovered was that if you interactively
Ngày tải lên: 22/04/2019, 13:45
Selection of a course of action by obstacle employment group based on a fuzzy logic system
... the combat operations, chiefly by armored and mechanized units, to hamper airborne assault landings, obstruct transportation and supply lines, inflict losses and create favorable conditions for ... that any area can be fuzzified and the conventional approach to the set theory generalized accordingly While calculating the time necessary to perform a task by a Serbian army unit, a very frequent ... decision-maker needs to rank several locations and chose one over the others Ranking the locations means attaching a value to each location, the overall goal being to choose the best from the set of available
Ngày tải lên: 04/02/2020, 13:40
A quality by experimental design approach to assess the effect of formulation and process variables on the extrusion and spheronization of drug-loaded pellets containing polyplasdone® XL-10
... Trang 1Research ArticleA Quality by Experimental Design Approach to Assess the Effect of Formulation and Process Variables on the Extrusion and Spheronization of Drug-Loaded Kalyan K Saripella,1,2Nikhil ... pellets, based on the model equations, was also accomplished MATERIALS AND METHODS Materials Polyplasdone® XL-10 (27 μm average particle size, hereafter Polyplasdone) was purchased from International ... spheronizer speed on the total yield appears in the model equation as both a main factor and as a factor in a two-factor interaction (Table III) Because it is involved in a two-factor interaction
Ngày tải lên: 11/05/2020, 11:54
Deep sequencing on a genome-wide scale reveals diverse stage-specific microRNAs in cambium during dormancy-release induced by chilling in poplar
... 13 0A-m0077_5p TTAAATGATGACATGGACACC scaffold_1:35822737:35822929 386 424 80 0A-m0108_5p GCTGGAGTAGCTCAGTTGGTT scaffold_4:16304187:16304406 399 760 151 0A-m0114_3p* TTGTACACAGAATAGGTGAAAT scaffold_5:1237647:1237753 ... 28 160 0A-m0146_5p TTCAGATCAGTAGATAGCATG scaffold_8:207755:207852 66 48 106 0A-m0078_5p TATTATTGTAAACAAGCTGAC scaffold_1:38115909:38116118 56 115 0A-m0045_5p GCCGTCTTAGCTCAGCTGGTA scaffold_15:14906320:14906473 ... TTAGAGAGAGCAGAAAGAACA scaffold_17:2570021:2570225 0 41 A-m0089_3p TGTTTGTCAGTGTGGTTGCGGTT scaffold_1:23370327:23370491 0 42 A-m0100_3p TAATATGTGGATATGCCAGCGG scaffold_2:22827035:22827254 0 46 A-m0107_3p*
Ngày tải lên: 27/05/2020, 00:07
Indirectly estimated absolute lung cancer mortality rates by smoking status and histological type based on a systematic review
... cell carcinoma rates Keywords: Lung cancer, Absolute rates, Squamous cell carcinoma, Adenocarcinoma, Smoking Background Extensive data are available by age, sex, year and country on lung cancer ... neoplasm of the trachea, bronchus and lung ICD = International Classification of Diseases. e Additionally includes carcinoma in situ. f For post-war/pre-unification epidemiological data, WHO data ... currently available evi-dence Another example is the case of adenocarcinoma It is apparent that rates of adenocarcinoma have been rising relative to squamous cell carcinoma, a change which has been
Ngày tải lên: 05/11/2020, 06:14
Bạn có muốn tìm thêm với từ khóa: