using methods and variables from a java class
Matrix Methods and Differential Equations: A Practical Introduction - eBooks and textbooks from bookboon.com
... Trang 1Matrix Methods and Differential Equations A Practical Introduction Download free books at Trang 2Wynand S Verwoerd Matrix Methods And Differential Equations A Practical Introduction Trang ... the variables An equation is a logical statement that one thing is equal to another The rules of mathematics tell us what we may legitimately do to combine and manipulate such statements, using ... constructing a test example in Maple or Mathematica One often learns as much from such trials that fail, as from the ones that do work as you expect! A useful strategy in such trials, is to start from an
Ngày tải lên: 21/01/2021, 19:47
Matrix Methods and Differential Equations: A Practical Introduction - eBooks and textbooks from bookboon.com
... Trang 1Matrix Methods and Differential Equations A Practical Introduction Download free books at Trang 2Wynand S Verwoerd Matrix Methods And Differential Equations A Practical Introduction Trang ... the variables An equation is a logical statement that one thing is equal to another The rules of mathematics tell us what we may legitimately do to combine and manipulate such statements, using ... constructing a test example in Maple or Mathematica One often learns as much from such trials that fail, as from the ones that do work as you expect! A useful strategy in such trials, is to start from an
Ngày tải lên: 21/01/2021, 21:09
Using maps and models as a tool for conservation and management in the age of the anthropocene pieces of evidence from indigenous protists and a local landscape of the philippine archipelago
... dataset The classification output was then assessed for accuracy by comparing the classes with Landsat data Following the evaluation and validation of the classification results, the data was ... mask and extract Landsat images for each dataset using the "Extract by Mask" tool in ArcToolbox.ArcMap 10.8 software was utilized to create the study area map essential for classification Finally, ... significant land-use and land-cover (LULC) changes due to rapid and uncontrolled population growth alongside industrialization.Land Use and Land Cover (LULC) change plays a crucial role across various
Ngày tải lên: 13/06/2023, 16:05
Using maps and models as a tool for conservation and management in the age of the anthropocene pieces of evidence from indigenous protists and a local landscape of the philippine archipelago
... 1973).dark-2.3 Land use/ Land cover classification using remote sensing and its application to coastline studies Several types of thematic data crucial to GIS analysis, such as data on land use andland ... theclassification was examined to see if the classification was done correctly by lookingat the classes and comparing it to the Landsat data After evaluating and validating the classification result, it was ... iswidespread and has been observed in a wide variety of habitats, including temperateforests (Kazunari, 2010; Takahashi & Hada, 2009), tropical rainforests (Dagamac, 2012),dry land ecosystems, and
Ngày tải lên: 23/06/2023, 09:07
Management principles of sustainable industrial chemistry theories concepts and industrial examples for achieving sustainable chemical products and processes from a non technological viewpoint
... Sustainability Assessment Methods andTools, discusses a sustainability assessment framework and impact indicators andassessment approaches from both a uni- and a multidimensional perspectives.The chapter argues ... chemistry Section 4: Managing vertical interorganizational sustainability Section 3: Managing horizontal interorganizational sustainability Section 2: Managing intraorganizational sustainability Figure ... conceptualized and Trang 13developed but also that innovative management models, intraorganization models,and interorganization models are elaborated, promoted, and implemented withinthe chemicals using
Ngày tải lên: 13/03/2018, 15:11
A study of idioms by food in english and vietnamese from a perspective of components
... grammar involves the description of what the speakers of a language do when they speak their language That certain language uses are categorized as acceptable or unacceptable according to a standard ... reveal that most of the idioms in both English and Vietnamese are analyzable and have meanings that are at least partly motivated The thesis also presents the implications for idiom teaching and ... study also reveal that most of the idioms in both English and Vietnamese are analyzable and have meanings that are at least partly motivated (Geeraets, 1995; Gibbs, 1990/1995; Kövecses & Szabo,
Ngày tải lên: 17/09/2019, 23:22
A study of idioms by clothes in english and vietnamese from a perspective of components
... systematical way Trang 27CHAPTER 3 DATA AND METHODOLOGY In this chapter, the author discusses the theoretical background related to theoretical and analytical frameworks Data collection, data analysis ... system of a language and make specific characteristics of each nation both material and spiritual values Hence, investigating the idioms in both English and Vietnamese always attracts many authors ... are analyzable and have meanings that are at least partly motivated The thesis also presents the implications for idiom teaching and translation Trang 6TABLE OF CONTENTS Page STATEMENT OF AUTHORSHIP
Ngày tải lên: 19/09/2019, 23:46
A study of idioms by food in english and vietnamese from a perspective of components
... grammar involves the description of what the speakers of a language do when they speak their language That certain language uses are categorized as acceptable or unacceptable according to a standard ... reveal that most of the idioms in both English and Vietnamese are analyzable and have meanings that are at least partly motivated The thesis also presents the implications for idiom teaching and ... study also reveal that most of the idioms in both English and Vietnamese are analyzable and have meanings that are at least partly motivated (Geeraets, 1995; Gibbs, 1990/1995; Kövecses & Szabo,
Ngày tải lên: 27/10/2019, 20:47
Knowledge sharing between marketing and accounting from a coopetitive perspective: Empirical evidence from Vietnam
... tests We measure formalization, lateral relations, informal networking, shared vision, MAKS, and competition between marketing and accounting departments, using adopted and adapted scales from the ... stimulate the integration of existing and newly acquired knowledge and enhance organizational units’ capacity to develop novel linkages and associations From the social capital perspective, informal ... Friedmann, 2008) In addition, organizations must be innovative to gain a competitive advantage for survival and to stay ahead of their rivals (Li & Calantone, 1998) Therefore, organizational
Ngày tải lên: 03/02/2020, 23:21
A study of idioms by clothes in english and vietnamese from a perspective of components
... systematical way Trang 27CHAPTER 3 DATA AND METHODOLOGY In this chapter, the author discusses the theoretical background related to theoretical and analytical frameworks Data collection, data analysis ... system of a language and make specific characteristics of each nation both material and spiritual values Hence, investigating the idioms in both English and Vietnamese always attracts many authors ... are analyzable and have meanings that are at least partly motivated The thesis also presents the implications for idiom teaching and translation Trang 6TABLE OF CONTENTS Page STATEMENT OF AUTHORSHIP
Ngày tải lên: 22/04/2020, 21:25
The unique transcriptional response produced by concurrent estrogen and progesterone treatment in breast cancer cells results in upregulation of growth factor pathways and switching from a
... upregulation of growth factor pathways and switching from a Luminal A to a Basal-like subtype Eleanor F Need1*, Luke A Selth2,3, Andrew P Trotta1,4, Damien A Leach1, Lauren Giorgio1, Melissa A O ’Loughlin1 ... findings from quadruplicate samples randomly hybridised to Illumina HumanWG-6v3 chips (Australian Genome Research Fa-cility, St Lucia, Australia) Raw transcript expression data was exported from ... our dataset and those of Ballare and Graham reveals significant enrichment of a canonical HRE in these sites c Comparison of the reads per peak between sites shared between all 3 data sets and the
Ngày tải lên: 23/09/2020, 00:12
Prepositions “in, on, at” in English and Vietnamese from a cognitive semantic perspective = Các giới từ "in, on,at" trong tiếng Anh và tiếng Việt dưới góc độ ngữ nghĩa học tri nhận. M.A. Thesis Linguistics: 602202
... accommodated as an integral part of Trang 2012 linguistic organization Metaphorical conceptualization is regarded as a factor that may interact with grammatical processes, and is viewed as an important ... they are conceptualized and making a comparison from the data collected The final aim is to give valid construals about spatial conceptualization processes that native speakers employ in the language ... trajector is near, inside or on top of the airport area Preposition on denotes physical contact between trajector and landmark, and necessitates viewing the landmark as one-dimensional space
Ngày tải lên: 23/09/2020, 21:00
“Achieve”, “Attain” and “Accomplish” from a Corpus-based Perspective = "Achieve", "attain" và "accomplish" dưới góc nhìn của phương pháp khối liệu. M.A. Thesis Linguistics: 602202
... immense advantages in language study such as easy manipulation of data at minimal cost, accurate data processing and limitation of human bias Crystal (1985) adds that this collection of data can be ... in-depth and detailed enough A more fruitful source for analysis is raw text corpora As presented earlier, corpora with their powerful computer databases and language analysis tools facilitate researchers ... syntactic choice speakers will make as in Leech et al (1994) - Semantics and pragmatics: how do near-synonyms differ from each other, as in Okada (1999), Oh (2000), Gast (2006) and Gries and David
Ngày tải lên: 23/09/2020, 22:57
Telephone conversation openings in english and vietnamese (from a language cultural perspective
... ways particular activities are carried out and signaled Using Conversation Analysis (CA) as the methodology, this study illustrates the cultural characteristics of the format and interactional ... conversation is a challenge to anybody learning a foreign language and remains a sensitive area in intercultural encounters, even for those who have mastered the basics of a foreign language and culture ... customs and other capabilities and habits acquired by man as a member of a society‟ (Tylor 1871:1 in Heather Joan Bowe, Kylie Martin 2007: 2) The relationship between language and culture has long
Ngày tải lên: 30/09/2020, 13:04
Achieve, attain and accomplish from a corpus based perspective
... immense advantages in language study such as easy manipulation ofdata at minimal cost, accurate data processing and limitation of human bias Crystal(1985) adds that this collection of data can be ... sense and frequencies of sense of achieve, attain and accomplish? (2) What are the similarities and differences in register of achieve, attain and accomplish? (3) What are the similarities and ... Trang 1VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OFPOSTGRADUATE STUDIES LÊ THỊ THU HỒNG “ACHIEVE”, “ATTAIN” AND “ACCOMPLISH” FROM A CORPUS-BASED
Ngày tải lên: 08/11/2020, 12:15
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx
... Lucilia cuprina Anopheles dirus Bombyx mori Manduca sexta Anopheles gambiae Anopheles gambiae Blattella germanica Drosophila melanogaster Manduca sexta Anopheles gambiae Anopheles gambiae Anopheles ... Removal of contaminating agents from the crude RNA extract was performed using a Qiagen RNeasy kit (Qiagen, Inc., Valencia, CA, USA) First-strand cDNA synthesis was carried out using a BD SMART RACE ... Udomsinprasert R, Pongjaroenkit S, Wongsantichon J, Oakley AJ, Prapanthadara L -A, Wilce MCJ & Ketterman AJ (2005) Identification, characterization and structure of a new Delta class glutathione transferase...
Ngày tải lên: 23/03/2014, 09:21
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA...
Ngày tải lên: 12/08/2014, 03:20
Sockets and Services from a Security Point of View
... mail service, on the other hand, is a large, complex piece of software that accepts data (mail) from and returns data to the client, as well as reads and stores data and configuration information ... that allowed an organization (or a person) to request an Internet address from a central authority and then expand on that name using their own authority Thus was born the Internet Domain Name ... can, maintain web page usernames and passwords separately from operating system usernames and passwords Log web access, and look for unusual patterns (excessive 404 errors, etc.) Security characteristics...
Ngày tải lên: 29/09/2013, 13:20
Báo cáo " English today and tomorrow from a critical perspective " pptx
... destroyed viable language and cultural groupings in the Americas and Australasia It is doubtful that economic globalization would have the same catastrophic impact in Europe, Asia and Africa For this ... "devastating effect of the process of language shift on actual individuals and their familial and social relations." Thirdly, in United States, Canada, the United Kingdom, Australia, New Zealand ... to a broader social and political context they are existing in and serving Pennycook [1] assumed that: The view of language or of language learning cannot be an autonomous one that backs away from...
Ngày tải lên: 28/03/2014, 11:20
Báo cáo y học: " Baseline factors predictive of serious suicidality at follow-up: findings focussing on age and gender from a community-based study" pdf
... National Health and Medical Research Council Grants 179805 and 79839, a grant from the AlcoholRelated Medical Research Grant Scheme of the Australian Brewers' Foundation and a grant from the Australian ... sociodemographic characteristics were undertaken separately for age group and compared within and between genders Analysis of continuous variables required One-way Analysis of Variance (ANOVA); Pearson's ... Psychiatry Access article References Commonwealth Department of Health and Aged Care: LIFE: areas for action Canberra: Commonwealth of Australia; 2000 Australian Bureau of Statistics: 3303.0 Causes...
Ngày tải lên: 11/08/2014, 16:22