using a web service as a datasource in ssrs 2008

... vocabulary, making it the cornerstone of language mastery. 2.1.1.2 The Importance of Learning vocabularyUnderstanding the importance of vocabulary is crucial for mastering a target language, as ... discipline has its own unique terminology Continuous vocabulary enrichment is essential and can be achieved through focused learning in various areas.Mastering vocabulary is crucial for language ... Charles II to Catherine ofBraganza It was her great love of tea that made it (fashion) (13)….Tea has long been regarded as beneficial for its ability to uplift spirits and alleviate minor ailments

Ngày tải lên: 03/07/2022, 07:07

... gradual intra-luminal pressure increase was accompanied by a correspond-ing increase in tonic EUS activity, to keep the sphincter closed and maintain continence At a threshold volume, measured ... Trang 10During filling, continence was maintained via intact afferent sig-naling from the bladder and intact somatic motor somatic control on the EUS Parasympathetic drive, primarily involved in ... minute and intra-luminal pressure increase of 1.4 ± 0.3 mmHg (n = 12; Figure 5A) The NMCs were associated with phasic increases in EUS–EMG activity that presumably maintained continence During

Ngày tải lên: 01/11/2022, 08:34

... harvested on each day of the assay, stained withhaemotoxylin and eosin and optically imaged in cross-section (Fig 3a–d) From arrival to harvest, the stratumcorneum layer was seen to increase in thickness ... Primary nanoparticle physico-chemical characterisation This study used BASF Levasil® 200 and Levasil® 50amorphous silica nanoparticles to optimise a 3D RSMNassay for nanomaterial test articles Transmission ... obtained using the original chemical-RSMN [30] approach The binucleate frequency data from these optimisation experiments are presented in Additional file 4 Dosing and characterising nanomaterial

Ngày tải lên: 04/12/2022, 10:35

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as  Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  ... over  time  and  space.  The rainy season starts in September, ends in  Trang 2January  and  accounts  for  75%  to  85%  of  the total  yearly  rainfall,  whereas  the  dry  season  lasts  up  ... Viet.  In  recent  years,  there  has  been  a  rapid  development  of  brackish  pond  area  in  the  province. As shown in Fig. 2, the total area of  brackish  water  shrimp  culture  has  increased 

Ngày tải lên: 22/03/2014, 12:20

... Kappa 2 GGTGATATCWTGMTGACCCAAWCTCCACTCTC Kappa 3 GGTGATATCGTKCTCACYCARTCTCCAGCAAT C region kappa primer TGGTGGGAAGATGGA Signal sequence/framework primers Gamma 1 GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG ... genital disease in guinea pigs Figure 8 Effect of DL11 scFv on HSV-1 genital disease in guinea pigs Panel A: Blisters of GH 5 days after instillation of HSV-1 into vaginal vault Several areas of ... Trang 1Open AccessResearch Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide Jianmin Chen, Sanat K Davé and Anthony

Ngày tải lên: 18/06/2014, 22:20

... medium was calculated such that half of the anolyte was replaced (approx 10 mL) Finally, a NaHCO3solution (the carbon source) was supplied into the anode compartment, in a similar manner, such that ... oxygen, thenal electron acceptor The aera-tion rate was adjusted to be slightly above 50 mL min1 to ensure that the catholyte was air-saturated15but did not evap-orate fast A batch run was considered ... inoculated with a bacterial source (an inoculum) from natural mud taken from a brownish water stream at a depth of 20 cm underneath the stream bottom in Ung Hoa, Hanoi, Vietnam Inoculation was

Ngày tải lên: 16/12/2017, 11:35

... excellence in clinical practice, research and education in European hematology” as stated in (EHA, 2006) EHA are also working to make the training in hematology less heterogenous and a first step towards ... this information and create good graphical user interfaces that dealt with this in a way that would be easy to understand That could also be a typical example of an external application that is using ... of a learning resource, ie achieving a certain level for an item, can also be described in the metadata This kind of information is then used for an alternative and personalised way of searching,

Ngày tải lên: 10/01/2020, 05:34

... Summarizing paragraph Trang 32(iv) Teacher‟s assessment and feedback A students‟ final feedback indicating their reactions towards the whole reading portfolio project and advantages and disadvantages ... Besides, as far as the teacher knows, reading is the main skill trained at secondary and high school Accordingly, the participants‟ reading skill cannot be too bad Besides, an interesting fact was ... such as problem solving, critical thinking, analyzing data, and being able to present facts and opinions orally or in written form (Dochy,2001; as cited in Birgin & Bakin, 2007) Those are particular

Ngày tải lên: 30/09/2020, 13:17

... Summarizing paragraph Trang 34(iv) Teacher‟s assessment and feedbackA students‟ final feedback indicating their reactions towards the wholereading portfolio project and advantages and disadvantages ... both personal andcollaborative encourages critical thinking Students who are reading, writing,discussing, and interacting with a variety of learning materials in a variety ofways are more likely ... solving, criticalthinking, analyzing data, and being able to present facts and opinions orally or in written form (Dochy,2001; as cited in Birgin & Bakin, 2007) Those areparticular skills that

Ngày tải lên: 08/11/2020, 15:07

... lti-critcria analysis; I;casiblc m casu res; S ustainablc dcvclo p m cn t; Q u a n g Tri P rovincc As rogards topography, Q u an g Tri has all types of topography: m ountains, hills, plains an d Coastal ... and their solutions can be rcached Hovvever, it is noted that MCA is subjective in its nature In case the quantitative d ata are available, quantitative analysis (i.e num erical modelling) can ... bcing attachcd to those ranges of variation [3Ị Bascd on this general dircction, a num ber of m cthods have bocn developcd and applied Each of them has its ovvn advantagcs and disadvantages Tablc

Ngày tải lên: 17/03/2021, 20:39

... singular, either: *It was raining a cat and a dog) ● The Use of Actives/Passives Normally a transitive verb phrase can be changed to a passive: The man kicked the pail/The pail was kicked by the man ... It was raining cats and dogs (=It was raining very hard), but not *It was raining dogs and cats The idiom phrase be left high and dry (but not *be left dry and high) means to be left without any ... less invariable, both in wording and in certain grammatical ways They cannot, therefore, be changed or varied in the way literal expressions are normally varied, whether in speech or writing Some

Ngày tải lên: 21/05/2021, 22:12

... educational process, with assessment being the overarching term that includes all aspects of evaluation and testing.Assessment is a term that has gained diverse meanings in language testing and ... pertains to metacognitive aspects Lastly, appropriate target language use advocates for employing the target language as the primary medium in language learning, integrating both communicative and ... individual needs of learners at all levels; and (iv) It has a lasting influence Thanasoulas (2000) emphasizes that when learners believe that effective learning only occurs in a traditional classroom

Ngày tải lên: 28/06/2022, 09:57

... researched as a feasible means of tackling the challenge of electrification, especially in rural and remote areas Recent times have seen an increasing number of research works focusing on Sub-Saharan ... is approximately double that of when a dam already exists This indicates that utilization of existing dams can result in significant savings in implementation Hamatwi et al [Hamatwi, Nyirenda and ... usage in remote areas A majority of the rural regions in Southeast Asia and Africa receive abundant sun-light (above 5.5 kWhr/m2 per day for most regions) [Jaffery, Khan, Ali et al (2014); Khan and

Ngày tải lên: 20/10/2022, 02:04

... using a passive lease scheme in a stateless SOA, availability and reliability could be improved A stateless SOA may use a passive lease to increase availability by introducing multiple endpoints ... potential Lease Constructs for SOAs In this paper, we introduce the concept of a lease as it applies to SOAs A lease is a constraint on the binding of a service requestor to a service provider and ... architectures and the concepts of an active lease which maintains state, and a passive lease to eliminate the need for the service provider to maintain a conversational state between service requestor and

Ngày tải lên: 20/10/2022, 12:51

... Summarizing paragraph Trang 32(iv) Teacher‟s assessment and feedback A students‟ final feedback indicating their reactions towards the whole reading portfolio project and advantages and disadvantages ... Besides, as far as the teacher knows, reading is the main skill trained at secondary and high school Accordingly, the participants‟ reading skill cannot be too bad Besides, an interesting fact was ... such as problem solving, critical thinking, analyzing data, and being able to present facts and opinions orally or in written form (Dochy,2001; as cited in Birgin & Bakin, 2007) Those are particular

Ngày tải lên: 06/12/2022, 09:27

... marketing activities such as informing, promoting, contacting, connecting and negotiating The Internet has provided customers a fast, easy and free access to information on real estate market, reducing ... and commercial application of the Internet as a global computer network, has led to significant changes in business enterprise, changing the internal relationships in organizations, as well as ... theoretical possibilities and practical applications of web site as marketing tool in the real estate agencies Keywords: internet, real estate brokerage, marketing communications, online marketing, web

Ngày tải lên: 02/01/2023, 12:05

... socio-economic value of coastal areas Additionally, human activities during the Anthropocene have severely affected many coastal habitats in Southeast Asia, leading to issues such as eutrophication and chemical ... dataset The classification output was then assessed for accuracy by comparing the classes with Landsat data Following the evaluation and validation of the classification results, the data was ... philippinensis was analyzed using MaxEnt, which generated an output file in ASCII format This file was then imported into ArcMap 10.4 for detailed visualization In ArcMap, the data was classified into

Ngày tải lên: 13/06/2023, 16:05

... classification was done correctly by lookingat the classes and comparing it to the Landsat data After evaluating and validating the classification result, it was converted to a polygon using ArcToolbox's ... the ASCII output file format from MaxEnt was imported into ArcMap10.3 software The map was then divided using a defined interval as a classificationmethod Based on projected habitat suitability, ... Trang 34After assigning the appropriate classes to the image, Interactive SupervisedClassification was used to classify the entire dataset After that, the output of theclassification was examined

Ngày tải lên: 23/06/2023, 09:07

... PRACTICAL BACKGROUND 1 Theorical background 1.1 Definition of teaching reading skill: Reading is a basic ability for acquiring a language Other than writing,speaking, and listening, it is inextricably ... teacher, aim to always improve So,teachers can do vary activity in teaching writing in the school by using Socrative There are 3 Stages in a reading lesson: Pre-Reading Stage, While-ReadingStage, ... Post-Reading Stage 1.2 The importance of pre-reading stage Pre-reading activities assist students in getting ready for the reading task byactivating the necessary schemata and encouraging them

Ngày tải lên: 27/07/2023, 10:57