updating a single row or set of rows

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19] ... Strassel, C., Baas, M.J., Salamero, J., ChasserotGolaz, S., Cazenave, J.P., De La Salle, C & Lanza, F (2001) Biosynthesis and intracellular post-translational processing of normal and mutant platelet ... forms Parallel analysis of the supernatants revealed a positive signal starting at 60 of chase and having a molecular mass (82 kDa) consistent with a fully mature form This band was not observed...

Ngày tải lên: 23/03/2014, 13:20

7 368 0
Analysis of the mechanical reaction of human endothelial cells to a single constant or transient uniaxial strain

Analysis of the mechanical reaction of human endothelial cells to a single constant or transient uniaxial strain

... Northampton, MA, USA) Cell force analysis was performed using a MATLAB 7.14 standalone (MathWorks, Natick, MA, USA) Statistical tests were performed using R 3.0.2 (The R Foundation for Statistical ... of ImageJ 1.44p [41], [42] macros and plug-ins, and the primary data processing and visualization were done in ImageJ, MATLAB 7.11 (MathWorks, Natick, MA, USA) and Origin 8.1 G (OriginLab, Northampton, ... Germany) to the main standalone program for cell force analysis 17 2.4.4 Cell Force Analysis The algorithms for cell force analysis (CFA) were developed in MATLAB and are described in detail...

Ngày tải lên: 19/11/2015, 15:46

84 348 0
PicturePath A single row of photos carries your reader from here to there.

PicturePath A single row of photos carries your reader from here to there.

... format Print: (Specify pages 9–12) Print Format: Landscape Page Size: Fit to Page Save Presentation format or Paper-saver format  Back | Paper-saver format  Build a picture path SNOWBOARDING ... Before&After BAmagazine.com ® i U X Build a picture path It’s out of the ordinary, attractive and easy, too a single row of photos carries your reader from here to there Here’s an easy way to make ... to Before & After Before & After magazine Before & After has been sharing its practical approach to graphic design since 1990 Because our modern world has made designers of us all (ready or not),...

Ngày tải lên: 01/03/2016, 22:20

12 317 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

... analysis of the DNase I family The mammalian group formed a relatively tight cluster, while the snake (E quadrivirgata, E climacophora and A blomhoffii), amphibian (X laevis, Rana catesbeiana, ... snakes and Japanese white rabbits were acquired, maintained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH, USA; revised 1985) Analytical methods DNase ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and...

Ngày tải lên: 20/02/2014, 23:20

8 502 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

... coordination The authors read and approved the manuscript Author Details 1Cardiothoracic Department, Royal Victoria Hospital, Belfast, Northern Ireland and 2Cardiothoracic Department, St James ... A: Alive D:Dead The postoperative mortality was 12.5% in our series due to ARDS Mitchell et al [8] reported a 20% mortality for Carinal Pneumonectomy and 11% for carinal plasty The overall mortality ... technical complexity of the operation and the natural history of lung cancer but, five year survival in excess of 40% for malignant disease may be anticipated in the absence of involved mediastinal...

Ngày tải lên: 10/08/2014, 09:22

7 314 0
Báo cáo y học: "A single amino acid substitution of the human immunodeficiency virus type 1 capsid protein affects viral sensitivity to TRIM5α" potx

Báo cáo y học: "A single amino acid substitution of the human immunodeficiency virus type 1 capsid protein affects viral sensitivity to TRIM5α" potx

... KewalRamani VN, Lifson JD, Bieniasz PD: A macaque model of HIV-1 infection Proc Natl Acad Sci USA 2009, 106:4425-4429 16 Kamada K, Yamashita T, Hatcho K, Adachi A, Nomaguchi M: Evasion from CypA- ... TRIM5alphas J Virol 2007, 81:7280-7285 24 Kuroishi A, Saito A, Shingai Y, Shioda T, Nomaguchi M, Adachi A, Akari H, Nakayama EE: Modification of a loop sequence between alpha-helices and of virus capsid ... http://www.retrovirology.com/content/7/1/58 Author Details 1Department of Viral Infections, Research Institute for Microbial Diseases, Osaka University, Osaka 565-0871, Japan and 2Max Planck Institute for Informatics, Campus E1.4,...

Ngày tải lên: 13/08/2014, 01:20

10 306 0
Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx

Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx

... Tambussi, J Weber Trial Physician Sarah Fidler Trial Statistician Abdel Babiker Data and Safety Monitoring Committee A McLaren (in memoriam), V Beral, G Chene, J Hakim Central Virology Laboratories ... K, Frater J, Matthews P, Payne R, Addo M, Gatanaga H, Fujiwara M, Hachiya A, Koizumi H, et al: Adaptation of HIV-1 to human leukocyte antigen class I Nature 2009, 458:641-645 Gaschen B, Taylor ... posterior mean rate of another dataset, for a fragment of the env C2V5 region [15] This mean rate prior was normally distributed, with a mean of 8.18 × 10-3 substitutions per site per year (standard...

Ngày tải lên: 13/08/2014, 01:21

14 365 0
Báo cáo y học: " Enhanced protein-energy provision via the enteral route in critically ill patients: a single center feasibility trial of the PEP uP protoco" ppsx

Báo cáo y học: " Enhanced protein-energy provision via the enteral route in critically ill patients: a single center feasibility trial of the PEP uP protoco" ppsx

... utilize conservative, reactionary approaches to optimizing nutrition For example, enteral feeds are started at low rates, are advanced slowly, and maintained at a target maintenance rate with no ... Day A, for the Canadian Critical Care Trials Group: A randomized trial of diagnostic techniques for ventilator-associated pneumonia N Engl J Med 2006, 355:2619-2630 Cahill NE, Dhaliwal RD, Day ... prescription of full volume, trophic feeds, or NPO was appropriate No formal sample size calculation was done as the primary purpose of this before and after study was to evaluate the feasibility and safety...

Ngày tải lên: 13/08/2014, 20:22

12 327 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

... is a row in the Orders table that also has a CustomerID of J6COM A copy of this row is stored in a DataTable named ordersDT The customersDT and ordersDT DataTable objects are related to each ... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent table...

Ngày tải lên: 24/12/2013, 01:17

6 433 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

... transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single blot OCT, organic cation transporter; CAT, cationic amino acid transporter Transporter ... Regulation of expression of the human organic cation transporter type (OCT1h), which also resides in the plasma membrane Transporter expression in 293 cells was assayed by initial rates of uptake of radiolabelled ... interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry U57609 For pEBTet ⁄...

Ngày tải lên: 23/03/2014, 09:21

8 331 0
A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

... speaking ability and what mistakes they might produce IV Oral language Definition of oral language oral language consists of short, fragmentary utterances in a range of pronunciation There is often a ... teachers understand their aims For example, it is obvious that in order to be able to speak a foreign language, it is necessary to know a certain amount of grammar and vocabulary Part of a language ... the sort of proficiency learners need Teaching a second language used to be aimed at enabling learners to read and appreciate class of literature Therefore, any teacher who was able to reach this...

Ngày tải lên: 29/01/2014, 10:33

44 1,5K 1
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... cluster of S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 (Figs and 3) All shared a codon usage and a G+C ... with identical orientation (Figs and 3A) Of these, five (ataP3, ataP5, ataP4, ataP10 and ataP7) are highly similar to known or putative genes that are known or proposed to be implicated in the ... complementation assays The ataP5, ataP4 and ataP10 genes were also independently inserted in the pIJ702 vector and the resulting plasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively (Materials and methods),...

Ngày tải lên: 21/02/2014, 01:21

9 729 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...

Ngày tải lên: 05/03/2014, 15:20

14 615 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

... via a short antiparallel b-sheet Ca2+ is coordinated by the mainchain carbonyl and side-chain carboxyl oxygens at the 12- or 14-residue loop One pair of EF-hands usually forms a globular domain ... ‘punctae’ and aggregates near the plasma membrane [1,6] The N-terminal region of STIM1 contains a canonical EF-hand motif and a predicted SAM domain Stathopulos et al [23,24] isolated the EF-SAM ... domains gate and regulate Orai channels Nat Cell Biol 11, 337–343 Spassova MA, Soboloff J, He LP, Xu W, Dziadek MA & Gill DL (2006) STIM1 has a plasma membrane role in the activation of store-operated...

Ngày tải lên: 07/03/2014, 00:20

9 466 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...

Ngày tải lên: 07/03/2014, 12:20

16 398 0
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

... GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast ... This unusual feature was attributed to a major change in the supramolecular organization of the peripheral antenna The absence of LHCII oligomers in these strains leads to the accumulation of LHCII ... and mf2 mutants were originally screened as unusual PSII mutants because they lack variable fluorescence – a signature of the absence of PSII [15] – but have a low (instead of a high) fluorescence...

Ngày tải lên: 07/03/2014, 15:20

10 411 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

... makes an angle of π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ... used by various authors in order to study rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic ... ) are adjacent |J| An important corollary of (ii), which exhibits a sharp contrast with the case of rigid rotations, is that the scaling ratio is bounded from above and below by an asymptotically...

Ngày tải lên: 14/03/2014, 22:20

53 384 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

... inactivation of soluble and immobilized penicillin amidase from E coli Kinetic analysis and titration of active site Bioorg Khim 3, 547–553 2598 25 Yamagami C, Takao N, Tanaka M, Horisaka K, Asada ... In order to interpret the biphasic character of the Hammett plots available for AGA and GGT, it was suggested that the breakdown of the tetrahedral structure proceeded via general acid catalysis, ... Perakyla M & Kollman PA (1997) A simulation of the catalytic mechanism of aspartylglucosaminidase using ab initio quantum mechanics and molecular dynamics J Am Chem Soc 119, 1189–1196 Liu Y, Guan...

Ngày tải lên: 16/03/2014, 01:20

10 427 0
Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

... used for in vitro mutagenesis: ELM13M14 (5¢-AAGTCCCAAAATATTATGGA TATGATGGCTCGATTTCTCGAG-3¢); ELE28 (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ... primers for E lagascae SCP-2 (SCPElNE, 5¢-ACTGGAA TTCAACTCAAGTCCCAAAATATTTTGGAT-3¢; SCPElCN, 5¢-TCATGGCGGCCGCTCACAGCTTCGACGGCTTGG GGAA-3¢) and E lagascae EF1 -a (ELEFF, 5¢-TATGGT GGTTGAGACTTTTGCAG-3¢; ... ergosterol or palmitic acid to the sample The values are mean ± SD from at least four different analyses Plant Type Ergosterol Palmitic Acid E lagascae E lagascae E lagascae E lagascae A thaliana A thaliana...

Ngày tải lên: 16/03/2014, 12:20

15 392 0
w