trace of a second rank tensor

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... HepG 2 cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaIsiteandBack 6I ... 00 Fetuin NeuAca2-3Galb1-3GalNAca1-O-Ser/Thr c 0 1.4 NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thr c NeuAca2-6(3)Galb1-4GlcNAc-R c Asialofetuin Galb1-3GalNAca1-O-Ser/Thr 66 83 Galb1-4GlcNAc-R Arylglycosides ... the annealing of the two following synthetic oligonucleotides For EGT 5¢- GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCG TTAACAGCTGTGAGTGTGCTCAGGAGAGCGAG CCAACATAAGATGGTCATGGTGGCG-3¢....

Ngày tải lên: 08/03/2014, 08:20

12 585 0
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

... initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putative poly (A) addition signal sequence, 5¢-AATAAA [17,18]. It encoded a predicted product of 255 amino acids with a molecular mass of 28.5 kDa, and ... detection reagents (Amersham Pharmacia Biotech, Piscataway, NJ). Animals were fed water and standard rabbit food and maintained on a 12 h light/dark cycle. Polyclonal antiserum to the peptide was raised ... proliferating cell nuclear antigen 2 (DmPCNA2) and DmPCNA1 in response to DNA-damaging agents. (A) Immunofluorescent analysis of the localization of V5-tagged DmPCNA2 and Flag-tagged DmPCNA1. DmPCNA2...

Ngày tải lên: 23/03/2014, 10:20

12 404 0
A History of Medicine SECOND EDITION doc

A History of Medicine SECOND EDITION doc

... Slaves apparently carried a 30-day warranty against certain disorders. For example, if a slave was attack ed by epilepsy within one m onth of purchase, the seller had to reclaim that slave an d ... remaining tissue is sewn shut. Female circumcision is seen as a way of ensuring chastity and was often practiced as a coming of age ritual and a prerequisite to marriage. HEALING RITUALS, TRADITIONS, ... scope and quality. Part of the problem was undoubtedly lack of systematic knowledge of anatomy, asepsis, anesthesia, and the failure of a small tribal unit to provide enough ‘‘clinical material’’...

Ngày tải lên: 06/03/2014, 16:20

626 383 0
Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx

Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx

... Association of Artificial Intelligence. Rada Mihalcea. 2003. The role of non-ambiguous words in natural language disambiguation. In Pro- ceedings of the Conference on Recent Advances in Natural Language ... sense-tagged corpus, the TWA Sense Tagged Data Set, manually pro- duced by Rada Mihalcea and Li Yang (Mihalcea, 2003), from text drawn from the British National Corpus. We calculated a ‘supervised’ ... Machine Translation, pages 101–112. Rada Mihalcea and Dan I. Moldovan. 1999. An auto- matic method for generating sense tagged corpora. In Proceedings of the 16 th Conference of the Amer- ican Association...

Ngày tải lên: 08/03/2014, 04:22

6 472 0
Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx

Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx

... sepa- rated, and they stand or fall together. Ron Paul understands that all three parts of this system of liberty have been under grave attack for decades, and that the main problem is the federal ... individual’s natural right to be free of assault and aggression, and of his right to keep the property that he has earned on the free market, and not have it stolen from him by confiscatory taxes ... coinage of the United States. “Without the automatic check of a gold standard,” wrote Professor William Quirk in the New Republic, “the Nixon and Carter administrations were able, in a remarkably...

Ngày tải lên: 15/03/2014, 09:20

111 1,2K 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA C N77G Forward ... Sequence Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G ... sequence of the second binding loop of the related family 1 cystatin, cystatin A, differs appreciably from that of cystatin B. Most notably, cystatin A lacks the essential His75 and instead has a Gly...

Ngày tải lên: 17/03/2014, 10:20

10 534 0
The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

... apokatastaesei panta, lego de humin, hoti Aelias aedae aelthe kai ouk epegnosan auton all' epoiaesan auto hosa aethelaesan. Kai gegraptai hoti tote sunaekan oi mathaetai, hoti peri Ioannon tou Baptistou ... eipen autois.] _Matt._ xvii. 11-13. [Greek: Aelias men erchetai apokatastaesei panta, lego de humin hoti Aelias aedae aelthen kai ouk epegnosan auton, alla epoiaesan auto hosa aethelaesan, [outos ... representation of events in the early part of the rising of the Jews under Barcochba; Judith is Judaea, Nebuchadnezzar Trajan; Assyria stands for Syria, Nineveh for Antioch, Arphaxad for a Parthian...

Ngày tải lên: 17/03/2014, 15:20

162 498 0
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

... of aerobically and anaerobically prepared apoFNR. Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested with trypsin, and after separation on Sepha- dex ... anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to five- fold alkylated apoFNR, and a minor signal of three- fold alkylated FNR (Fig. 1B). Therefore, aerobic and anaerobic ... MALDI-TOF spectra of peptides derived from carboxymeth- ylated aerobic (A) and anaerobic (B) apoFNR (trypsin digest). The samples (carboxymethylated tryptic digest of aerobic or anaerobic apoFNR)...

Ngày tải lên: 23/03/2014, 15:20

10 478 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

... six b-strands (bAtobF) and two a- helices (aA and aB) (Fig. 4). The structure of the C378G variant of SAP97 PDZ2 was practically identical to that of C378S variant, except for the mutated residue, and ... 890–907) of GluR -A and of two variant PDZ2 domains in unliganded state at 1.8–2.44 A ˚ resolutions. SAP97 PDZ2 folds to a compact globular domain comprising six b-strands and two a- helices, a typical ... that trans- genic mice expressing GluR -A variant lacking seven C-terminal residues display apparently normal synaptic plasticity and basal GluR -A localization [10], suggest- ing developmental...

Ngày tải lên: 30/03/2014, 10:20

11 458 0
w