there are three basic steps in a dna extraction

Basic Steps in Disaster-Recovery Planning

Basic Steps in Disaster-Recovery Planning

... the plan Keep your backup tapes as fresh as possible and store them properly Also, be certain that tape devices remain clean and are in a clean environment Since tapes are relatively fragile, ... business can be up and running again According to statistical data, more than 75% of all companies in the United States rely on this technique This is understandable, since tape backup is a traditional, ... management and recovery teams Vendor call out and escalation lists Inventory and report forms Carrier call out and escalation lists Maintenance forms Hardware lists and serial numbers Software lists and...

Ngày tải lên: 28/10/2013, 14:15

8 290 0
Tài liệu There Are Billions of Dollars in Undetected Tax Refund Fraud Resulting From Identity Theft docx

Tài liệu There Are Billions of Dollars in Undetected Tax Refund Fraud Resulting From Identity Theft docx

... that also includes data from the SSA Operation Mass Mailing Database The Operation Mass Mailing database is a database of all tax returns identified as Operation Mass Mail by the Accounts Management ... September 30 Individual Master File An IRS database that maintains transactions or records of individual tax accounts Individual Returns Transaction File An IRS database containing transcribed tax returns ... Acting Director Sharla Robinson, Acting Audit Manager Sharon A Buford, Senior Auditor Karen C Fulte, Senior Auditor Jonathan W Lloyd, Auditor Ryan C Powderly, Auditor J Edward Carr, Audit Evaluator...

Ngày tải lên: 18/02/2014, 04:20

40 323 0
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

... multiple catalytic domains have been identified – two-domain arginine kinases [19–21], a two-domain carbonic anhydrase [22], a three- domain luciferase [23] and a threedomain adenylate kinase [24] ... separate individual domains: D1, MfeI and XhoI; D2, XhoI and AatII; D3, AatII and AvrII PCR using Ex Taq HS polymerase (Takara USA, Santa Ana, CA, USA) was performed to fill in the sticky ends and ... 9.1ab 5. 1a 14. 0a 1.1ab 7. 6a 11. 6a 0. 1a ± ± ± ± ± ± ± ± 34.9 19.8ab 11. 1a 30. 4a 2.4ab 16. 5a 24. 9a 0. 2a a Values that are significantly different from wild-type (P < 0.05) Mutants that are significantly...

Ngày tải lên: 16/03/2014, 06:20

9 570 0
Báo cáo lâm nghiệp:"Root biomass distribution under three cover types in a patchy Pseudotsuga menziesii forest in western Canada" pptx

Báo cáo lâm nghiệp:"Root biomass distribution under three cover types in a patchy Pseudotsuga menziesii forest in western Canada" pptx

... seedlings and some pinegrass; and (3) grassy openings: these are dominated almost exclusively by pinegrass, and are notable for their absence of trees greater than 1.3 m in height There has been ... separated by cover type Faint horizontal lines indicate the mean value across all three cover types Heavier, short lines indicate means within each cover type In Figure 4b, values next to each ... Pit locations under each cover type are indicated Cover types: G, Grassy opening; M, Mature forest; R, Regeneration clump coarse fragments in the soil Pits were located in areas that appeared representative...

Ngày tải lên: 08/08/2014, 01:21

6 305 0
Four basic steps in essay writing

Four basic steps in essay writing

... restaurant in town However, I’m going to eat my birthday dinner at McDonald’s When I compare the two restaurants, the advantages of eating at McDonald’s are clear For one thing, going to the Chalet ... Specific details - attract the readers’ interest - make your essay interesting to read - easy to understand because the readers always enjoy learning particulars about people, places and things Specific ... hand Illustration signals: For example for instance specifically As an illustration once Such as Conclusion signals: Finally, In conclusion, In summary In a nut shell, As a result, Indeed, In...

Ngày tải lên: 28/02/2015, 17:54

54 831 1
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

... Polyamine aggregates and DNA L D’Agostino et al Fig Interaction of single nuclear aggregates of polyamines (NAPs) with different DNA forms (A) Small-size NAP (s-NAP) interacting with A- DNA Grey ... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging, ... 2005 FEBS L D’Agostino et al Polyamine aggregates and DNA A B Fig Nuclear aggregates of polyamines (NAPs) protect genomic DNA from DNase I and, at the same time, in uence DNA conformation The electrophoretic...

Ngày tải lên: 23/03/2014, 15:20

11 383 0
A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc

A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc

... early 1990s predictions are available in a searchable database online at the site Imagining the Internet: A History and Forecast and they are also the basis for a book by Anderson titled Imagining ... southeast Alaska has been preserved in an online database used by schoolchildren in Glacier Bay More places are seeing the development of indigenouslanguage projects and databases online Broadband ... of internet users hailing from the U.S or Canada at this point in time While there are other nations in which English is a dominant language, including the United Kingdom and India (where Hindi...

Ngày tải lên: 29/03/2014, 19:20

115 445 0
Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium

Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium

... Heat and Mass Transfer Flow through Porous Media, Polar fluid, Stratified flow etc He has 48 papers in the related area, 34 of which are published in Journals of International repute Also he has ... Orissa (India) from 1982-2004 and presently working as the Head of the faculty of Physics in KBDAV College, Nirakarpur, Orissa (India) since 2004 He has 27 years of teaching experience and 10 years ... field near the plate upto a certain distance and thereafter the flow behaviour reverses An increase in suction parameter/Reynolds number increases the temperature of the flow field at all points...

Ngày tải lên: 05/09/2013, 14:58

12 497 0
Three Men in a Boat bộ sách tiếng anh dùng để học từ vựng

Three Men in a Boat bộ sách tiếng anh dùng để học từ vựng

... !'tl: F / c a a L ) z , o )Vl (9 q> , ;ur \'X -r I lr L t r q o / c ! o ! < -ul F A g o (9 g z r .a c t{ c g d, E d L .o lr C \lt a f A J J t v u h z a - A) t{ a A J ll | { E J & S a c o | F c ... ss U) l-r l.r (t t -a q ta lt ( *, t 'g € Ir !,1 || i rf lr \ t Jr ) o U * c j qJ q) q) \ -s F a E E A I o o Ir J > X {) o c o o J af C+ l- A F rt B I { z z5 x at J !r , l ^ \A A lr J -l J o Z t ... IEigff*!iEE ;lFg'EEiAEE g ; ?e E E ! i F !r i f sgEi i'i!EEsi ii iilil: :! E ;; r Ea; € Fi+est;sr;i '.ri f ( ! 3 > H o d - € E ( l J e v f5"G s ' J EH-.e D t o r l - Fa o E a) q) L -\ F* a ) G '-t t...

Ngày tải lên: 22/11/2013, 11:14

44 1,2K 11
10 steps in developing a strategic social media plan for your business

10 steps in developing a strategic social media plan for your business

... track Capture multiple analytics as some metrics may later become a better KPI af ter you have had the experience of measuring and analysing the data Roll out st rat egy Once you have f inalized ... of social media at solving that problem Choose a metric that’s indicative of that goal’s progress and is easy to measure Social media evolves rapidly so your tactics may have to change later T ... need to develop a social media strategy that will generate meaningf ul and real returns f or the business T he 10 steps in developing a strategic social media are: Align with the business Discover...

Ngày tải lên: 07/01/2014, 15:27

6 834 0
Tài liệu Art of Surface Interpolation-Chapter 5:Solving special tasks In the next sections there are examples of interpolation problems, ppt

Tài liệu Art of Surface Interpolation-Chapter 5:Solving special tasks In the next sections there are examples of interpolation problems, ppt

... part of a racing car body was interpreted to obtain results outside the domain determined by points XYZ Fig 5. 2a: Aerodynamic resistance data measured at a small part of a racing car body As the ... estimate of new snow volume in an avalanche field after an avalanche event is presented Two data sets were available for solving this problem – AVALAN.DT0 containing the measurement of snow surface ... before the avalanche event and AVALAN.DT1 containing the measurement of snow surface after the avalanche event In figure 5. 5a there are two maps of snow surfaces created from the above-mentioned...

Ngày tải lên: 21/01/2014, 07:20

17 506 0
Tài liệu Make a Generic Search Form in a Visual Basic .NET docx

Tài liệu Make a Generic Search Form in a Visual Basic .NET docx

... in Listing 8.18 into the form Taking the strKeyValue passed from the results of the search, a data adapter is created and a DataSet is filled Next, the individual data row is created Last, each ... ID Label Caption Company Name Label Caption Contact Label Caption Contact Title Label Caption Address Label Caption City Label Caption Region Label Caption Country Label Caption Phone Label Caption ... btnAccept_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles btnAccept.Click Dim dtFromGrid As DataTable Dim drCurr As DataRow Try ' Using the DataRow and DataTable objects of the DataGrid...

Ngày tải lên: 26/01/2014, 11:20

13 343 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

... can be controlled by changes in DNA topology inducing formation of non-B DNA structures within the binding sites [11,12] Interactions of p53 with DNA are regulated mainly via post-translational ... preferential binding to globally cis-platinated DNA [31,33,34] Binding of p73 proteins to the recognition elements is affected by DNA cis-platination in a similar way to p53 binding In agreement ... a clinically used anticancer agent [26,27] The drug binds covalently to DNA, forming several kinds of adduct, among which the most abundant are intrastrand crosslinks (IACs) between neighboring...

Ngày tải lên: 19/02/2014, 05:20

14 600 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... described in (A) Lysates were prepared at the indicated times after the ADR addition and analyzed for caspase activity by using a fluorometric substrate-based assay Each point is the mean of triplicate ... expression of c-Fos and c-Jun, via the MAP kinase signaling pathway TAM67 retains the DNA binding and leucine-zipper region of c-Jun, but it lacks the transactivation domain of c-Jun (amino acids 1–122) ... hemagglutinin- conjugated upper primer was 5¢-GGAATTCCGCCACCATGCCATA CGATGTTCCAGATTACGCT-3¢ The XbaI restriction site-conjugated lower primer was 5¢-GCTCTAGAGCTCA TTTCCGACTGAAGA-3¢ Amplification...

Ngày tải lên: 19/02/2014, 06:20

13 496 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... gradient and assayed for alkaline phosphatase activity (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate ... deoxycholate ⁄ 0.05% (w ⁄ v) SDS in NaCl ⁄ Pi] A protease inhibitors cocktail (antipain, aprotinin, chymostatin, elastatinal, leupeptin, pepstatin A) was added to cell lysates and media (10 lgÆmL)1 ... alkaline phosphatase gene from hypophosphatasia patients J Bone Miner Res 13, 1827–1834 Cai G, Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada...

Ngày tải lên: 19/02/2014, 17:20

14 446 0
Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx

Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx

... building and mutational analysis Protein Eng 4, 891–901 Ogata, K., Morikawa, S., Nakamura, H., Sekikawa, A. , Inoue, T., Kanai, H., Sarai, A. , Ishii, S & Nishimura, Y (1994) Solution structure of a ... Ichikawa-Iwata, E., Sasaki, M., InoueBungo, T., Shiina, M., Kimura, K., Takata, S., Fujikawa, A. , Morii, H., Kumasaka, T., Yamamoto, M., Ishii, S & Ogata, K (2002) Mechanism of c-Myb-C/EBP beta cooperation ... Myb–UBC9 interaction, and by determination of reporter activation using both a 5-bromo-4-chlorindol-3-yl b-D-galactoside overlay and a liquid b-galactosidase assay (Fig 3) Similar analysis of several...

Ngày tải lên: 21/02/2014, 00:20

11 558 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢...

Ngày tải lên: 07/03/2014, 12:20

16 398 0
w