the development of written languages were a result of

... as compared to that of ASEAN-5 Besides, the structure of the economy of both ASEAN-5 and Vietnam has changed towards industrialization It could be seen that the share of manufacturing of ASEAN-5 ... efficiency can reach at a nearly average level of ASEAN-5, and financial broadening have increased after 2005 However, it is proved that the development of financial market in ASEAN-5 is more sustainable ... concerned, the ASEAN-5 financial systems were about ten times as large, with the total financial assets of 80% of GDP on average In Vietnam, financial depth has been a rather shallow with the underdeveloped

Ngày tải lên: 14/03/2014, 17:20

... riboflavin + catalase; PRC, ParA1 + riboflavin + catalase; other abbreviations follow the same pattern.] Trang 6The EPR method, a reliable way to analyse the for-mation of OH• [48,49], was applied ... pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A400, 400 l M ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra were representative of at least ... through the Fenton reaction [50] ParA1, PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were infiltrated into the same leaves of tobacco

Ngày tải lên: 15/03/2014, 00:20

... University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA Email: Debra E Irwin* - dirwin@email.unc.edu; James W Varni - JVarni@archmail.tamu.edu; Karin Yeatts - Karin_Yeatts@unc.edu; ... for an interview date At the time of the interview, a trained research assistant obtained parental informed consent and the children signed an assent document All child participants received a ... with any qualitative study, the item development team had to make judgments as to the importance of an item problem and whether revisions were necessary We tried to adhere to the operationalization

Ngày tải lên: 18/06/2014, 19:20

... is also shown (black vertical line) Trang 7Statistical AnalysisAll PPs were analyzed through a two-way ANOVA, with vision (EO vs EC) and age as factors Each condition was then separately analyzed ... of the parameter does not remarkably vary over time The same applies for all the parameters object of the analysis All PPs were calculated by retaining the first 30 seconds after Tset Four of them ... time after stepping on the force plate is crucial: the majority of the parameters used to define the postural ability are summary measures, and their application is based on the assumption of stationar-ity,

Ngày tải lên: 19/06/2014, 10:20

... in the level of circulating DNA was observed in ash.DNase I trans-genic mice These data demonstrate that the therapeutic use of a recombinant actin-resistant, salt-resistant and hyperactive DNase ... from the development of anti-nuclear antibodies and associated pathol-ogy by reducing the circulating levels of antigenic nuclear components, we have taken advantage of the mutant murine DNase ... demonstrated that the treatment was safe No change in serum markers of dis-ease were observed, however, perhaps due to the fact that catalytically active levels of the enzyme in the circulation were

Ngày tải lên: 09/08/2014, 07:20

... patients were on antidepressant medication, and all had seen their clinicians on at least two occasions for standard treatment and standard psycho-education as a part of standard clinical care ... University of Calgary, 3330 Hospital Drive NW, Calgary AB T2N 4N1, Canada Email: Adel Gabriel* - gabriel@ucalgary.ca; Claudio Violato - violato@ucalgary.ca * Corresponding author Abstract Background: ... standard psychiatric treatments (anti-depressants, antipsychotics, electroconvulsive therapy, and admission to a psychiatric ward) were more often rated as harmful than helpful, and some nonstandard

Ngày tải lên: 11/08/2014, 17:20

... 5'-ATTGCCTCTGCAACATCTCG-3' Reverse: 5'-ATGAAGAAGGCCAGGAGGTT-3' LPA4 Forward: 5'-ACTGCGTTCCTCACCAACAT-3' Reverse: 5'-CGATCGGAAGGGATAGACAA-3' LPA5 Forward: 5'-GCTCCAGTGCCCTGACTATC-3' Reverse: 5'-CAGAGCGTTGAGAGGGAGAC-3' ... receptors and COX-2 LPA1 Forward: 5'-TCAACCTGGTGACCTTTGTG-3' Reverse: 5'-GGTCCAGAACTATGCCGAGA-3' LPA2 Forward: 5'-ATATTCCTGCCGAGATGCTG-3' Reverse: 5'-AAGCTGAGTAACGGGCAGAC-3' LPA3 Forward: 5'-ATTGCCTCTGCAACATCTCG-3' ... time a role for LPA2 in the development of airway inflammation and pathogenesis of asthma Materials and methods Animals All the mice were bred and housed in a specific pathogenfree barrier facility

Ngày tải lên: 12/08/2014, 14:20

... replicaconcentra-tion of the minimized rtTAΔ6A and rtTAΔ6B variants is significantly faster than that of the parental HIV-rtTA virus and even faster than the wild type LAI virus Similar results were ... Amsterdam, Amsterdam, The Netherlands and 2 Department of Paediatric Oncology, Emma Children Hospital, Academic Medical Center of the University of Amsterdam, Amsterdam, The Netherlands Email: Rienk ... construction of rtTAΔ6A and rtTAΔ6B, the wild-type tat open reading frame is restored when compared to the rtTA virus that carries the Y26A inactivating Tat muta-tion Although Tat-mediated transcriptional

Ngày tải lên: 13/08/2014, 09:20

... Asian-American and Latin-Asian-American children The parents of the children of these Oakland kindergarten classes were asked to give written consent to allow their children to partici-pate in the ... beginning of the kindergarten year At the end of the kindergarten year Asian-American M(SD) Latin-American M(SD) Asian-American M(SD) Latin-American N = 65 N = 65 male n = 17 female n = 10 male ... begin-ning of the kindergarten year The Asian-American chil-dren increased and the Latin-American chilchil-dren decreased the avoidance of conflicts over the course of the kindergar-ten year At the

Ngày tải lên: 13/08/2014, 18:21

... it appears No wonder Gladstone said that the surest way to the madhouse was The ancients made the mistake of believingthat the world was the center of the universe and all of their calculations ... currency All thisin effect nullifiesthe National Bank-ing Act, which provides for National Bank and also the act levying an annual tax of 10 percent on all State BankCurrency As the Banks of the ... Private Bankers 60 Henry D Lloyd on the Guernsey Financial French Assignats 79 State Banks in America 96 Condition of American Banks 101 The Bank of the State of South Carolina .108 TheStateBank

Ngày tải lên: 05/11/2014, 10:07

... Trang 1APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI-GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE JAYASANKER JAYABALAN DEPARTMENT OF ELECTRICAL AND COMPUTER ... conventional integrated circuit (IC) packaging, test and burn-in are done after the IC is packaged using package formats such as Quad Flat Package (QFP), Ball Grid Array (BGA), or Chip Scale Package (CSP) ... conductance component22 G Let τ be the interaction time delay between the two capacitances Then, the MNA (modified nodal analysis) equations of the equivalent circuit can be written as The time factor

Ngày tải lên: 11/09/2015, 14:24

... serves as a tissue for haematopoiesis during gestation, the vascular development in liver is essential Angioblasts, precursors of endothelial cells, start to appear near the hepatoblasts at the stage ... hindgut are generated owing to invaginations at the anterior and posterior ends of the embryo Albumin, a characteristic marker of hepatic specification, can be detected at the ventral foregut By the ... (Matsumoto et al., 2001) The hepatoblasts remain in a morphologically undifferentiated state until day 12 of gestation in the mouse (Medlock and Haar, 1983) Then the differentiation of the hepatocyte

Ngày tải lên: 11/09/2015, 16:06

... b 2are based on the different usages of shang But in Type B all classifications are based on the meaning of the preceding noun We can “use grammaticalization as an explanatory parameter to account ... and THE PERCENTAGE OF NORMALIZED SHANG as the longitudinal axis Figure 1 “The Development of Shang in Type A” From the statistical data of Type A1 we can see that the percentage of “normalized ... shang-phrases “not only means the act has been done, but also emphasize the result of the act.” (Huang, 2007) And shang is used to show that the act has a result Principle of the classification

Ngày tải lên: 12/10/2015, 17:36

... Australia b Graduate School of Management, University of Western Australia, Perth, WA 6009, Australia Abstract Value creation is widely discussed in the practitioner literature and is often a ... both reliable and valid in this context as well The PERVAL scale has a variety of potential applications and can serve as a framework for further empirical research in this important area © 2001 ... example, the purchase of an attractive carpet is likely to increase the chances of a favorable emotional as well as a favorable functional response Trang 4Conse-quently, value dimensions may

Ngày tải lên: 24/09/2016, 18:06

... The discrepancy in the data and lack of accuracy in reported data is likely to cause supply demand constraints in the future and hamper the progress of this technology The objective of this thesis ... calculate the depreciated value of the original car as it passed down and repaired throughout car’s useful life, based on the final price of the vehicle obtained after modeling accidents, damages ... Hazardous Waste Processes Batteries that are likely to end up in hazardous waste site may generate harmful air emissions and can be modeled for their environmental impact based on the type of

Ngày tải lên: 10/12/2016, 09:56

... the top 500 largest enterprises of Vietnam; Vietnam Golden Star Award, ranked in the top 100 Banks of Asia Pacific’s Strongest Balance Sheet Award and ranked in the top 500 of Asia Pacific Largest ... Commercial banks play a key role in the economy both at national and global level The importance of commercial banks include the fact that they serve as a trusted and safe place where the funds of ... Largest Banks by the Asia Banker Journal (the leading Journal in the field of banking and financial services in Asia Pacific) 2.1.2 An overview of Ocean Bank – Hanoi Branch 2.1.2.1 History of Ocean

Ngày tải lên: 13/12/2017, 23:46

... following the initial awareness raising activities Village heads were also informed up to 5 days in advance of the activities and were requested to notify participants of the groups of their role in the ... individuals Trang 25A related issue to the above practicalities of the activity is the location of the piloting activity The choice of an appropriate venue is important in terms of making people ... In particular, local people had clearly not understood the conditionality of REDD+ benefits on the basis of actual performance They were unaware of the novelty of REDD+ even though they had participated

Ngày tải lên: 09/01/2018, 10:05

... for that matter, the connections among the frame elements However, as the new members grow and learn in the ways of the profession, their understanding of the individual frame elements – and the ... scaffolding, and game-based learning Dr Xun Ge is an Associate Professor with the Program of Instructional Psychology and Technology, Department of Educational Psychology at the University of Oklahoma Her ... in the course materials Another student, Janet, had been an occupational therapist for many years She provided some policy guidelines and actual assessment examples for assessing special education

Ngày tải lên: 10/01/2020, 11:04

... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081 ... number MAP1b-for MAP1b-rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG 82898–82923 83581–83552 NC_000076 Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067...

Ngày tải lên: 23/03/2014, 05:22