surface engineering quantum dots at the air water interface

Gas transfer at the air-water interface in a turbulent flow environment pdf

Gas transfer at the air-water interface in a turbulent flow environment pdf

... velocity fluctuations At the water surface any turbulent transport has to vanish as turbulent structures can not penetrate the air- water boundary Therefore, in the immediate vicinity of the boundary, ... enhancing the gas exchange process near the air- water interface because wind-shear is generated at the water surface which is directly in the vicinity of the interfacial region where the primary ... of the oxygen concentration field near the water surface • measurements of the oxygen concentration in the bulk region Concurrently to the three main measurements, the temperature of the water...

Ngày tải lên: 29/03/2014, 18:20

151 333 0
Báo cáo hóa học: "Mechanical tuning of molecular machines for nucleotide recognition at the air-water interface" pot

Báo cáo hóa học: "Mechanical tuning of molecular machines for nucleotide recognition at the air-water interface" pot

... Steroid Cyclophanes at the Air- Water Interface J Am Chem Soc 2000, 122:7835-7836 Ariga K, Nakanishi T, Terasaka Y, Tsuji H, Sakai D, Kikuchi J: Piezoluminescence at the Air- Water Interface through ... Cyclen Monolayer at the Air- Water Interface J Am Chem Soc 2006, 128:14478-14479 Ariga K, Michinobu T, Nakanishi T, Hill JP: Chiral Recognition at Air- Water Interfaces Curr Opin Colloid Interface Sci ... between the phosphate and the Li+ ion These results clearly indicate that the recognition of aqueous nucleotides can be tuned both by the surface pressure and the presence of Li+ ion, although the...

Ngày tải lên: 21/06/2014, 04:20

6 244 0
Tài liệu Báo cáo khoa học: "Negative Polarity Licensing at the Syntax-Semantics Interface" doc

Tài liệu Báo cáo khoa học: "Negative Polarity Licensing at the Syntax-Semantics Interface" doc

... 3: connect the Uterals The final step in assembling the proof net is to connect together the literal nodes at the top of the graph It is at this stage that unification is applied to the variables ... readily applied to the other categories of NPI as well In the case of the NPI quantifier phrase anyone the licensing apparatus is added to the earlier template for everyone to produce the meaning constructor ... 'hypothetical' material All of the NPI licensing occurs within the hypothetical (left) side of the outermost implication Since the l resource is made available to the NPI only within this hypothetical,...

Ngày tải lên: 22/02/2014, 03:20

7 276 0
Báo cáo khoa học: Mutagenesis at the a–b interface impairs the cleavage of the dystroglycan precursor doc

Báo cáo khoa học: Mutagenesis at the a–b interface impairs the cleavage of the dystroglycan precursor doc

... our data and other evidence from the literature, we propose the following scenario for DG maturation (shown in Fig 7): immediately after translation, the DG core protein is translocated into the ... address these points At the present stage, our identification of multiple point mutations that inhibit or affect the DG maturation pathway may provide a useful tool to investigate and shed light on the ... 5¢-CTCATGTATGGCCTGGCTGAC AGCAGCCATGTG-3¢ P565A reverse: 5¢-CACATGGCTGCTGTCAGCCAG GCCATACATGAG-3¢ S654A forward: 5¢-CAGAACATCACTCGGGGCGC TATCGTGGTGGAATGGACC-3¢ S654A reverse: 5¢-GGTCCATTCCACCACGATAGCGC...

Ngày tải lên: 16/03/2014, 02:20

13 268 0
Báo cáo khoa học: Protein oligomerization induced by oleic acid at the solid–liquid interface – equine lysozyme cytotoxic complexes potx

Báo cáo khoa học: Protein oligomerization induced by oleic acid at the solid–liquid interface – equine lysozyme cytotoxic complexes potx

... Sepharose matrix + Sepharose matrix Sepharose matrix + Fig 10 Schematic representation of the ELOA formation at the solid–liquid interface within column chromatography (A) The Sepharose matrix is ... display the minimum at 230 nm typical of the native state equine lysozyme spectrum at 25 °C, but exhibit the same shape as the spectrum for the equine lysozyme molten globule at 57 °C (Fig 2B) At ... presented in Fig The near-UV CD spectrum of ELOA (Fig 2A) at 25 °C is much less structured than that of the native state equine lysozyme, i.e the minima at 305 and 291 nm, and the maximum at 294 nm...

Ngày tải lên: 30/03/2014, 01:20

15 321 0
Báo cáo hóa học: "Friction and Shear Strength at the Nanowire–Substrate Interfaces" pdf

Báo cáo hóa học: "Friction and Shear Strength at the Nanowire–Substrate Interfaces" pdf

... loading further changed the postbuckling shape of the NW until sliding occurred at the NW–cantilever interface After buckling of the NW, there exist two forces at the NW–substrate interface, a compressive ... is very likely that the NW is not perfectly perpendicular to the substrate Edge of the NW tip could be in contact with the substrate, and the contact area can then be approximately fitted with ... among the contacting surfaces [22]; as a result the true contact area is typically proportional to the normal force The NW–substrate contact is treated as the singleasperity contact because the...

Ngày tải lên: 22/06/2014, 00:20

5 303 0
Báo cáo hóa học: " Drying nano particles solution on an oscillating tip at an air liquid interface: what we can learn, what we can do" pot

Báo cáo hóa học: " Drying nano particles solution on an oscillating tip at an air liquid interface: what we can learn, what we can do" pot

... humidity, the pressure gradient is estimated as the ratio of the saturated vapor pressure (at the air water interface) to the shortest distance of the meniscus The shortest distance may be estimated ... vapour, as the air at infinity is not saturated the vapour diffuses outward Using the saturated pressure at the air liquid interface, we start with the Darcy law, from which the evaporating flow ... the wet part of the tip Therefore, in itself the structure of the deposit evidences the strength of the interaction between the nanoparticles and the tip In the latter case, the strength of the...

Ngày tải lên: 22/06/2014, 18:20

10 350 0
báo cáo khoa học: "Determination of pore size distribution at the cell-hydrogel interface" ppt

báo cáo khoa học: "Determination of pore size distribution at the cell-hydrogel interface" ppt

... deformation of the alginate matrix due to cell growth and the consequent modification of the pore size distribution pattern can give us very important information about modulation of rates of ... Beside the determination of the dimension of the cavities forming the alginate matrix, our methodology allowed us to determine the alginate fibril-like structure width, which is higher in the case ... surrounding alginate, thereby obtaining values of relative radii of these cavities The number of times the same value was repeated is hereafter dubbed the frequency All distance transformation-based...

Ngày tải lên: 11/08/2014, 00:23

7 364 0
Báo cáo hóa học: " The Role of Intrinsic and Surface States on the Emission Properties of Colloidal CdSe and CdSe/ZnS Quantum Dots Giovanni Morello Æ Marco Anni Æ Pantaleo Davide Cozzoli " potx

Báo cáo hóa học: " The Role of Intrinsic and Surface States on the Emission Properties of Colloidal CdSe and CdSe/ZnS Quantum Dots Giovanni Morello Æ Marco Anni Æ Pantaleo Davide Cozzoli " potx

... that the relative weights of the two fastest components is too slight to feature the CW time integrated PL spectrum We observe that the time constant t1 and t2 are the typical carrier relaxation ... recombination from ± 1U and ± 1L states and the transition |3i to a surface states emission By analysing the temperature dependence of the PL intensities I1, I2 and I3 for the three states, we ... different in the two studied samples, suggesting that the nature of the transition |3i (Fig 1A) is extrinsic Also, we can rule out that the longest decay arises from an intrinsic state, like the ± ‘‘dark’’...

Ngày tải lên: 22/06/2014, 18:20

3 343 0
Construction engineering students' evaluation of the esp programme at vinh university

Construction engineering students' evaluation of the esp programme at vinh university

... Furthermore, the learners’ evaluation on the time allocation for ESP in the courses in chart shows their satisfaction toward the time allocation in the courses 1, The learners not satisfy with the ... evaluate the time allocated for the second course is enough while 43.3% the learners think that the time allocated for the third course is little and 50.6% the learners think that the time allocated ... the information on the learners’ evaluation of the ESP for Construction at Vinh university; relating to the time allocated for the learning ESP in the courses, the contents and general evaluation...

Ngày tải lên: 07/11/2012, 14:54

44 506 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

... if water is provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic ... recirculated, in such a way that the air becomes saturated (see Figure 1) The adiabatic saturation temperature, Tad sat, is the temperature that the air reaches when gets to the output of the tunnel, ... system is the heat-exchange surface that separates the air stream from the water to be evaporated These surfaces absorb heat from the primary air stream and transfer it to the secondary air in the...

Ngày tải lên: 05/09/2013, 16:10

28 654 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA ... CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG CAAAGCGATCTTATTCTTTT...

Ngày tải lên: 18/02/2014, 06:20

15 476 0
Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx

Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx

... etc.) M Thiriet, Signaling at the Cell Surface in the Circulatory and Ventilatory Systems, Biomathematical and Biomechanical Modeling of the Circulatory and Ventilatory Systems 3, DOI 10.1007/978-1-4614-1991-4_1, ... that originate at the plasma membrane use a set of proteic and lipidic mediators (Table 1.1) These mediators either possess a catalytic function or participate in the regulation of the activity ... Bachelard) The set of books devoted to Circulatory and Ventilatory Systems in the framework of Biomathematical and Biomechanical Modeling aims at providing basic knowledge and state of the art on the...

Ngày tải lên: 05/03/2014, 22:21

999 3,2K 0
American Carrier Air Power at the Dawn of a New Century docx

American Carrier Air Power at the Dawn of a New Century docx

... carrier battle groups deployed at any time, while the others and their attached air wings remained at home in various states of maintenance and requalification training that rendered them undeployable ... in the immediate aftermath of the attacks The Department of Defense and the carrier battle group commanders also initiated moves to update contingency plans for naval strike operations in the ... coordinates only after getting airborne That pattern began to predominate at around the war’s eleven-day point when the Department of Defense indicated that the campaign had shifted from attacking...

Ngày tải lên: 15/03/2014, 16:20

139 313 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

... between the substrate and the active oxygen species to generate product Previous data have led to the conclusion that the species responsible for oxygenation of substrate is the diferryl intermediate ... shows the effect of increasing catalase concentrations (0, 2.4, 4.8 and 7.2 lM, respectively) The effect of ventilating the reaction at the highest catalase concentration was also investigated as ... of the products of substrate oxygenation by the adsorbed MMOH was achieved by holding the potential at )0.5 V for 30 in the presence of substrate and then removing the liquid (50 lL) from the...

Ngày tải lên: 17/03/2014, 09:20

6 466 0
Control of Dioxins (and other Organochlorines) from the Pulp and Paper Industry under the Clean Water Act and Lead in Soil at Superfund Mining Sites: Two Case Studies in EPA''''s Use of Science potx

Control of Dioxins (and other Organochlorines) from the Pulp and Paper Industry under the Clean Water Act and Lead in Soil at Superfund Mining Sites: Two Case Studies in EPA''''s Use of Science potx

... be inadequate to achieve uses designated by the States; and developing strategies for achieving ambient water quality standards in these impaired waters Section 303 of the 1987 Clean Water Act ... 1987 Clean Water Act Amendments directed States to develop lists of their impaired waters by 1989 Impaired waters are those bodies that not meet or are not expected to meet ambient water quality ... 1993a, p 20 The BCF is used to estimate the concentration of a substance in fish tissue based on its concentration in water) EPA (1993a, Attachment A-12) also estimates that the proposed BAT would...

Ngày tải lên: 24/03/2014, 05:20

65 644 0
enemy at the water cooler - real-life stories of insider threats & enterprise security management countermeasures

enemy at the water cooler - real-life stories of insider threats & enterprise security management countermeasures

... employees at the facility were afraid that they were about to lose their jobs.Therefore they sabotaged the technology Interestingly, we may then say that the first computer crime was perpetrated by ... organizations, the threat is smaller than that associated with criminals The intelligence organizations of the world have the capacity to be a more formidable cyber threat than any other.They have ... the threats and knowing how to spot them in the business processes Enemy at the Water Cooler is a must read for CIOs and security officers everywhere, but it is also part of the literature that...

Ngày tải lên: 25/03/2014, 11:14

285 421 0
CEEH Scientific Report No 3: Assessment of Health­Cost Externalities of Air Pollution  at the National Level using the EVA Model System  docx

CEEH Scientific Report No 3: Assessment of Health­Cost Externalities of Air Pollution  at the National Level using the EVA Model System  docx

... externalities at the national level The essential idea behind the EVA system is that state-of -the- art methods are used in all the individual parts of the impact-pathway chain Other comparable ... For the non-linear process, the tagged concentration fields are estimated by first adding the background and tag concentration fields, then applying the non-linear operator (e.g the chemistry) The ... reduction have been set by the European Commission, such as the so-called thematic strategy for air pollution and the NEC (National Emission Ceilings) strategy For the year 2020 the emission scenario...

Ngày tải lên: 29/03/2014, 14:20

98 635 0
w