... Trang 1Design and Analysis of Clinical Study 1 Research Questions & Study Design Dr Tuan V Nguyen Garvan Institute of Medical Research Sydney, Australia Trang 2The Utility of Science“The ... causes of events and help to predict events and outcomes Trang 11Research ProcessPhenomenon of Interest Research Question Target Population Study Plan Operational Variables Sample Population Actual ... variables not appropriate Analysis Inappropriate analysis Trang 13Internal and External ValiditySample Target Population Sample Sampling Comparison Measurement Analysis Conclusion Internal
Ngày tải lên: 20/04/2022, 14:51
... 42] 43] 40] 41] 39 38 Fung ksi (e/D =1.5) (e/D =2.0) 108 | H10 | 108 | 111 [110 | 112 | 412 | 116 | 405 | 10g | 108 | 111 | 106 | 109 | 99 | 102 | 95] 98! 143 | 139 | 137 | 141 | 139 | 142 | 142 ... ! | ! h 180 210 | 200 170 | 185 150 190 | 180 140 | 150 158 200 ; 189 147 158 117 136 | 130 111 | 120 297 346 | 330 280 305 360 420 | 400 340 370 225 285 : 270 210 | 225 247 313; 297 231 | 247 ... 14 | 1177| 116 [ 119 |- 108 | 110 | 110 | t5 | 109 | 112] 102] 105} 98] tor 95 “ (e/D=20) M44} 48] 146] 150] 139 | 142] 142] 147 | 140] 144] 131) 135] 126] 130 122 H8 Pry, kai (/Đ=1.5) 92] 97|
Ngày tải lên: 07/08/2014, 10:20
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt
... positions [33] However, no copies of pAv34 were detected within the 13 kb BAC [EMBL:DQ374018] and the 11 kb BAC [EMBL:DQ374019] that contain a tan-dem array of the HinfI-satellite consisting of 14 and ... 21 5 29 38 - 100 ED029002 ACTGAAAAAAAATGAAGACTA BvMSat07 30 4 32 90 - 100 ED019743 GAAAAAATAAGTTCAGATCAGATCAGATCA BvMSat08 32 1 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT BvMSat09 32-39 ... repeat size [bp] c 0 t-1 hits G/C-content [%] identity [%] EMBL accession representative monomere sequence BvMSat01 10 7 34 40 - 100 ED023089 AACTTATTGG BvMSat11 15 1 41 36 - 100 DX580797 TAAATAGTCAAGCCC
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: "Wound healing and inflammation genes revealed by array analysis of ''''macrophageless'''' PU.1 null mice" ppt
... AW1450597 Helis EST AI035334 EST AW047134 EST AI836641 EST AA623379 Zfp101 Clk1 Zfp97 Thra EST AI957030 Rbmx EST AI648091 Cbp143 Impact Tpr EST AA189811 MTCP1 EST AI131982 EST AI838094 EST AA717740 ... AA199023 Sh3bgr1 Ars2 EST AI848330 EST AA816121 EST AA866655 Ppicap Elf3 Wsb1 Ifit3 Zac1 EST AI844043 EST AA755234 Cyp2b19 Kitl Fin16 Ifit1 EST AI553463 Fmr1 Czp-1 EST AI837467 Gtf2h1 EST AI836552 ... n=172 n=38 n=131 n=17 Late effector n=46 0 100 200 300 400 500 600 700 800 0 50 100 150 200 250 300 350 400 0 200 400 600 800 1000 1200 0 50 100 150 200 250 300 0 50 100 150 200 250 300 350
Ngày tải lên: 14/08/2014, 14:21
Analysis of regulator of g protein signaling (RGS) function in growth, development and pathogenicity of magnaporthe grisea 1
... Figure 10 A B C D Figure 11 Non-inductive Figure 12 TMT1398 1h 3h 7h 12h WT Figure 13 A TMT1398 WT 1d 4d _ B WT TMT1398 Figure 14 A WT TMT1398 B WT TMT1398 Figure 15 ... MagB………………………… 114 4.2.12 Physical interaction between Rgs1 and MagC…………………… ……114 4.3 Discussion……………………………………………………………………… 117 4.3.1 Rgs1 regulates MagA for appressorium development………………… 117 4.3.2 ... expression in wild-type and rgs1∆ 11 3 Figure 37 Rgs1 interacts with MagB………………………………………………… 11 5 Figure 38 Rgs1 physically interacts with MagC……………………………………… .11 6 Figure 39 Soft surfaces... nutrients
Ngày tải lên: 14/09/2015, 09:13
Genetic analysis of phytoene synthase 1 (Psy1) gene function and regulation in common wheat
... in-fluencing YPC and gene expression, the mutation sites of M090122 (V171I) and M091151 (R174K) were adjacent to the177DXXXD181domain, and the mutation in M091217 (R309K) was close to the 302DXXXD306 domain ... Transcriptional profiling underlyingPsy1 down-regulation Totals of 1,128,107, 1,160,285, 1,192,915 and 1,228,928 unigenes were obtained for transgenic lines 273-2A, 275-3A, 279-1A and the control, ... mutations in Psy-A1 (M091151 and M090122), the Psy-A1 expression levels in homozygous mutants were more than 33 % of that in wild-type plants, and the compensatory response began at 14 or 28 DPA For
Ngày tải lên: 22/05/2020, 04:56
Bài giảng Thiết kế thí nghiệm và xử lý số liệu (Data Analysis and Design of Experiment): Bài 1 - PGS. TS. Trịnh Văn Dũng
... mẫu 03.10.2017 Trang 9XÁC SUẤT – THỐNG KÊ & THỰC NGHIỆM- nêu giả thuyết -kiểm nghiệm giả thuyết -thiết lập quan hệ nhân quả 03.10.2017 Trang 10XÁC SUẤT – THỐNG KÊ & THỰC NGHIỆM1.1 Quan ... Xác suất: tung con xúc xắc X = (1, 2, 3, 4, 5, 6) 03.10.2017 Trang 21XÁC SUẤT – THỐNG KÊ & THỰC NGHIỆM1.3 Sự kiện và đại lượng ngẫu nhiên Phép thử ngẫu nhiên (Randomness tests): kết quả thu ... nhờ quan sát 03.10.2017 Trang 11XÁC SUẤT – THỐNG KÊ & THỰC NGHIỆM1.1 Quan sát và thực nghiệm Q ự g ệ Thực nghiệm có nhược điểm: -Thiếu thực tế: không thể quan sát hết Trang 12XÁC SUẤT – THỐNG
Ngày tải lên: 17/07/2021, 08:39
A DESCRIPTION AND ANALYSIS OF STATE POLICY FRAMEWORKS REGARDING ORDER OF SELECTION UNDER TITLE I OF THE REHABILITATION ACT
... outlined in Section 101(a)(5)(C) of the Act and 34 CFR 361.36(a)(3)(iv)(A).“individual with a significant disability” is defined in Section 7(21)(A) of the Act and 34 CFR 361.5(b)(31) as an individual ... individuals, as mandated by Section 101(a)(5)(A) of the Rehabilitation Act of 1973 and 34 CFR 361.36(a)(1) This decision should be made before the start of each fiscal year and reassessed whenever ... accordance with [34 CFR 361.47(a)(13)].Under section 101(a)(10)(c)(ii)(I) of the Act and 34 CFR 361.37, agencies are required to provide annual reports detailing the number of eligible individuals
Ngày tải lên: 20/10/2022, 09:00
leishmania braziliensis replication protein a subunit 1 molecular modelling protein expression and analysis of its affinity for both dna and rna
... (Figure 3A) Similarly, the K172, W189 and F214 amino acids of the LbRPA-1 protein would be the equivalent to residues K343, W361 and F386 described as crucial for DNA-binding in the DBD-B domain of ... lysozyme, 10μg/mL DNase I, 10 μg/mL RNase A and 1% Triton X-100, pH 8.0), incubated on ice for 30 min and then 1 mM PMSF was added This mixture was centrifuged, and the pellet was suspended in 10 mL of ... tertiary structure of the RPA-1 C- terminal end and modulates DNA-binding [36] The motif, C-X2-C-X15-C-X2-C, lo-cated at the 313– 335 position in L braziliensis sequence (Figure 1), is absolutely
Ngày tải lên: 02/11/2022, 14:27
genetic analysis of phytoene synthase 1 psy1 gene function and regulation in common wheat
... in-fluencing YPC and gene expression, the mutation sites of M090122 (V171I) and M091151 (R174K) were adjacent to the177DXXXD181domain, and the mutation in M091217 (R309K) was close to the 302DXXXD306 domain ... Transcriptional profiling underlyingPsy1 down-regulation Totals of 1,128,107, 1,160,285, 1,192,915 and 1,228,928 unigenes were obtained for transgenic lines 273-2A, 275-3A, 279-1A and the control, ... mutations in Psy-A1 (M091151 and M090122), the Psy-A1 expression levels in homozygous mutants were more than 33 % of that in wild-type plants, and the compensatory response began at 14 or 28 DPA For
Ngày tải lên: 04/12/2022, 10:36
Bài giảng thiết kế thí nghiệm và xử lý số liệu (data analysis and design of experiment) bài 1 pgs ts trịnh văn dũng
... https://fb.com/tailieudientucntt Trang 41.1 Quan sát và thực nghiệm 1.2 Sai số của phép đo 1 3 S kiệ ẫ hiê đ i l & biế ố ẫ hiê 1.3 Sự kiện ngẫu nhiên, đại lượng & biến số ngẫu nhiên 1.4 Chuỗi số biến đổi ... https://fb.com/tailieudientucntt Trang 31 Những khái niệm cơ bản của xác suất thống kê2 Lý thuyết xác suất 3 Cá thô ố đặ t ủ ố liệ th hiệ 3 Các thông số đặc trưng của số liệu thực nghiệm 4 Bài tập 03.10.2017 CuuDuongThanCong.com ... Trang 1THIẾT KẾ THÍ NGHIỆM VÀ XỬ LÝ SỐ LIỆU Ệ Ệ(Data Analysis and Design of Experiment) PGS TS Trịnh Văn Dũng Bộ môn: Quá trình và thiết
Ngày tải lên: 27/02/2023, 07:59
Đo kiểm đánh giá can nhiễu mạng truyền hình cáp The Measurement and Analysis of the effect of interference in Television Cable network
... chọn nhƣ sau: + n = 1 với d mea ≥ 30m. + n=0,8 với 10m ≤ d < 30m. + n=0,6 với 3m ≤ d < 10m. 3) 3.2.3 Tiêu chuẩn áp dụng: Áp dụng tiêu chuẩn châu Âu: ETSI EN 302 262 V.1.1.1: Tƣơng thích điện ... phân giải ( KHz) 30-230 30 10 120 230-1000 37 10 120 Chú ý: Áp dụng giới hạn thấp hơn tại tần số chuyển tiếp Bảng 3.3: Các giới hạn đối với nhiễu phát xạ của các mạng có tần số trên 30 MHz IV. CHƢƠNG ... channel coding and modulation for 11/12 GHz satelite services – European Broadcasting Union. 11. Eugene R.Bartlett - Cable communications technology – McGraw Hill. 12. EN 300 429 V1.2.1(1998-04) –
Ngày tải lên: 26/11/2013, 20:44
Tài liệu An Introduction to Intelligent and Autonomous Control-Chapter 8: Modeling and Analysis of Artificially Intelligent Planning Systems ppt
... sequence of input actions transfers the state from xọ=”object lin position 3 and object 2 in position 7 and manipulator in position 5" to x7="object 1 in position 5 and object 2 in position 10 ... one more definition of stability We assume that we can partition the set of possible input and output symbols into disjoint sets of "good" and "bad" inputs and outputs A system ... positions of the manipulator and objects For two objects, the initial state might be xg="object 1 in position 3 and object 2 in position 7 and manipulator in position 5" Notice that part of
Ngày tải lên: 14/12/2013, 12:15
Báo cáo khoa học: Effect of priming on activation and localization of phospholipase D-1 in human neutrophils potx
... mechanisms Clin Sci 94, 461–471. 2 Exton, J.H (1998) Phospholipase D Biochim Biophys Acta 1436, 105–115. 3 Serrander, L., Fallman, M & Stendahl, O (1996) Activation of phospholipase D is an ... Trang 1Effect of priming on activation and localization of phospholipase D-1in human neutrophils Karen A Cadwallader1, Mohib Uddin1, Alison M Condliffe1, Andrew S Cowburn1, Jessica F White1, Jeremy ... (2001) Presence of a phospholipase D (PLD) distinct from PLD1 or PLD2 in human neutrophils: immunobiochemical characterization andinitial purification Biochim Biophys Acta 1530, 97–110. 11 Arcaro,
Ngày tải lên: 07/03/2014, 15:20
Integrated Assessment of Health and Sustainability of Agroecosystems - Chapter 1 pptx
... Analysis 80 3.3.3 Problem Analysis and Action Planning 81 3.3.3.1 Problem Identification, Ranking, and Analyses 81 3.3.3.2 Preference Ranking and Action Planning 82 3.3.4 Follow-Up 82 3.3.4.1 Collective ... 70 3.2.5.3 Monitoring, Evaluation, Planning, and Assessments 70 3.3 Results 70 3.3.1 Community Identities 71 3.3.1.1 Participatory Mapping 71 3.3.1.2 Institutional Mapping 71 3.3.1.3 Historical ... Villages 98 4.3 Results 98 4.3.1 Githima 99 4.3.2 Gitangu 104 4.3.3 Kiawamagira 109 4.3.4 Mahindi 110 Trang 18xxii Contents4.3.5 Gikabu 113 4.3.6 Thiririka 117 4.4 Discussion 122 4.4.1 Construction
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Managing variability in the summary and comparison of gait data" pot
... σ Z ab 1 24 1.36 0.158 79.19 0.0171 2 23 1.74 0.734 7.513 0.232 p = 0.31 p = 0.036 γ (,,) () / xab ba xe x otherwise a axb = ≥ () −− 1 0 0 7 1 Γ Journal of NeuroEngineering and Rehabilitation ... the data. 0.5 1 1.5 2 2.5 3 0 5 10 15 Stride period (s) Number of strides Stride period distribution − child #1 with CP 0.5 1 1.5 2 2.5 3 0 1 2 3 4 5 6 Stride period (s) Number of strides Stride ... (mode I/mode 2) 0.71/0.29 0.73/0.27 - Critical value (lower) 33.35 32.96 30.40 Critical value (upper) 53.89 51.70 50.40 ˆ () ()fx Wgx Xii i N C = () = ∑ 1 6 gx e i i x ii () ()/ = − 1 2 22 2 σπ µσ
Ngày tải lên: 19/06/2014, 10:20
Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc
... extract 85 .3 3696 0.0 23 1 100 Ammonium sulfate ppt 87.4 516 0 .17 7 10 2 Phenyl Sepharose CL-4B 71. 9 76 0.95 41 84 BioScale DEAE10 36 .5 17 .4 2 .10 91 43 Table 3. Activity of Qor in crude extracts of ... (Uặmg )1 ) Purication (-fold) Yield (%) Crude extract 31 2 30 45 0 .10 1 100 Ammonium sulfate ppt 2 71 416 0.65 6.4 87 Phenyl Sepharose CL-4B 299 78 3. 83 37.5 96 BioScale DEAE10 206 9 .3 22 .1 216 .7 66 15 72 ... restriction site of pSUP202 [44], resulting in pBG3a and pBG3b. Competent E. coli S17 -1 cells were transformed with pBG3a and pBG3b. Mating of E. coli S17 -1 pBG3a/3b and P. putida 86 -1 was performed as...
Ngày tải lên: 17/03/2014, 10:20
Review and analysis of renewable energy perspectives in Serbia
... Elektromorava 13 13 HPP Limske 211 211 Hydro-Power Plants 2.8 31 2. 835 Power Plants Owned by EPS 8 .35 5 8 .35 9 HPP Piva 34 2 34 2 HPP Gazivode 35 35 Other Power Plants 37 7 37 7 Total 8. 732 8. 736 Source: ... 08 11 6.628 2,84 Dec 08 12 1.854 2,88 Apr 08 99.660 2,87 Jan 09 12 0.6 91 2,78 May 08 89.8 41 2,76 Feb 09 10 6 .30 2 2,85 June 08 82.905 2,75 Mar 09 10 6.5 01 2, 73 July 08 98. 2 13 2,97 Apr 09 73 .11 5 ... 20 3, 29 36 9, 03 2002 2,42 35 1, 58 22 2,94 42 6,94 2005 2,25 30 1, 98 27 3 ,17 43 7,40 2006 2,59 35 1, 77 24 3, 00 41 7 ,36 2008 2,67 35 1, 92 25 3, 02 40 7,62 Source: [14 ] As one can observe,...
Ngày tải lên: 05/09/2013, 16:10
E-Recruiting Categories and Analysis of Fortune 100 Career Web Sites
... 42 41 83 Job application tools Profile update 25 26 51 Job basket 21 15 36 Job agent 17 14 31 E-mail application 8 13 21 Regular mailing application 2 8 10 Fax application 1 5 6 ... 18 38 FAQ 13 16 29 Culture 15 14 29 Employee testimonials 13 11 24 Training 14 9 23 Interview tips 7 9 16 recorded with respect to all 33 attributes. In order to analyze the use of ... site 37 35 72 Use of third-party job boards Hotjobs 38 38 76 Monster 39 32 71 Careerbuilder 31 27 58 E-recruiting methods Job search engine Category 40 38 78 Location 38 ...
Ngày tải lên: 24/10/2013, 08:20
Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx
... K cat (s )1 ) Pta 44.9 ± 4 .1 1 .3 ± 0 .3 2 .1 ± 0.2 23 .1 ± 2 .1 29.6 ± 2 .3 Pta–F1 28.5 ± 5.2 2 .1 ± 0.4 1. 5 ± 0 .1 0 .38 ± 0 .1 0. 23 ± 0 .1 Pta–F2 39 .1 ± 5.5 1. 3 ± 0.2 1. 9 ± 0.2 0.05 ± 0.02 0.029 ± 0. 01 Pta–F3 ... 15 20 25 30 Ac-P synthesis activity (%) Ac-P synthesis activity (%) 10 0 11 0 12 0 13 0 14 0 Ac-CoA synthesis activity (%) 0 20 40 60 80 10 0 12 0 14 0 0 20 40 60 80 10 0 12 0 14 0 Ac-P synthesis activity ... synthesis activity (%) 0 20 40 60 80 10 0 12 0 0 20 40 60 80 10 0 12 0 Ac-P synthesis activity (%) No addition NADH Pyr ATP PEP [PEP] (mM) 10 0 10 5 11 0 11 5 12 0 0 0.5 1. 0 1. 5 2.0 [Pyruvate] (m M ) 0 5 10 15 ...
Ngày tải lên: 06/03/2014, 11:20