steady state entropy production profile in a mtbe reactive distillation column

steady state compressible fluid flow in porous media

steady state compressible fluid flow in porous media

... (39) ) M sin  L zavc Tav R c z av  Average gas deviations factors evaluated with Tav and pavc and 2 +p p p av c = All other variables remain as defined in previous equations In isothermal flow ... Average gas deviations factors evaluated with Ta v and p a v b T a v = Arithmetic average Temperature of the porous medium = 0.5(T1+T2), p a vb p2  0.5aa pb All other variables remain as defined ... Flow in Porous Media 481 z a v = Average gas deviation factor evaluated with Ta v and p a v T a v = Arithmetic average temperature of the porous medium given by 0.5(T1 + T2) and p ava = p 2 + aa...

Ngày tải lên: 27/07/2014, 23:44

35 298 0
Báo cáo khoa học: "Activation domain in P67phox regulates the steady state reduction of FAD in gp91phox" pot

Báo cáo khoa học: "Activation domain in P67phox regulates the steady state reduction of FAD in gp91phox" pot

... contains an NADPH-binding site that participates in catalysis by the leukocyte NADPH oxidase J Clin Invest 1996, 98(4), 977-83 Someya A, Nagaoka I, Yamashita T Purification of the 260 kDa cytosolic ... produced < 2% steady state reduction of heme based on absorbance changes at 558 nm minus 540 nm Activation domain in p67phox regulates the steady state reduction of FAD in gp91phox 29 Table Effects ... used steady state kinetics to investigate whether the activation domain in p67phox stimulates the reductive Abo A, Boyhan A, West I, Thrasher AJ, and Segal AW Reconstitution of neutrophil NADPH...

Ngày tải lên: 07/08/2014, 14:22

5 240 0
Báo cáo khoa học: "Modelling canopy growth and steady-state leaf area index in an aspen stan" pptx

Báo cáo khoa học: "Modelling canopy growth and steady-state leaf area index in an aspen stan" pptx

... graphic tablet The overstory leaf area index, used as a reference value in this study, was calculated as the sum of P tremula and B pendula leaf areas The total canopy clumping index was calculated ... have a strong influence on canopy LAI Little data on time-series of LAI is available to show considerable variability For instance, 619 Burton et al [5] measured intra-annual variability in LAI ... bifurcation and light makes canopy LAI very sensitive to small variations in parameters, implying that precise measurements are required In contrast, small fluctuations in annual global radiation...

Ngày tải lên: 08/08/2014, 14:22

11 232 0
Báo cáo y học: "Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation" pdf

Báo cáo y học: "Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation" pdf

... propagation Theor Biol Med Mod 2005, :17 Koura T, Hara M, Takeuchi S, Ota K, Okada Y, Miyoshi S, Watanabe A, Shiraiwa K, Mitamura H, Kodama I, Ogawa S: Anisotropic conduction properties in canine ... propagation velocity in the core chain was the same as that in the surface chain, as found in the present study In summary, the present study demonstrates that longitudinal propagation velocity in ... of each chain in order to limit the total number of traces to 60 (20 chains × markers/chain) All electrical parameters were the standard values; the variables were as follows One variable was...

Ngày tải lên: 13/08/2014, 23:20

9 201 0
Báo cáo y học: " Altered retinal microRNA expression profile in a mouse model of retinitis pigmentosa" docx

Báo cáo y học: " Altered retinal microRNA expression profile in a mouse model of retinitis pigmentosa" docx

... retinal miR expression data from Ambion microarray analysis Additional data file is a table listing highly ranked retinal miR target genes predicted using miRanda The miRNA array data are available ... provided age Global rankedprovided Retinalage a variance data out ranked and P347S retinasvalues Additionalforratios are ratios was carried retinaltriplicate.Student's Click herealso file was miR target ... data are available with the online version of this paper Additional data file is a table listing retinal miR expression data from Exiqon microarray analysis Additional data file is a table listing...

Ngày tải lên: 14/08/2014, 08:20

12 338 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

... regulatory proteins Gal4p, Gal80p, Gal3p and activated Gal3p, respectively Model I includes sequential binding of activated Gal3p to DNA-Gal4p–Gal80p Parameter m represents cooperativity during binding ... which can be obtained through simpler experiments Thus, steady- state analysis can be used as a tool to establish the actual mechanism prevalent inside the cell by eliminating infeasible mechanisms ... GAL genes in a mutant strain of Saccharomyces cerevisae lacking GAL80: Quantitative Model and Experimental Verification Biotechnol Appl Biochem 39, 89–97 20 Broach, A. R (1979) Galactose regulation...

Ngày tải lên: 07/03/2014, 16:20

11 494 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

... rate at which TP disappears in time at steady state after the rapid initial increase The pronounced biphasic character of the inhibition profiles in Fig 1A C is explained by the presteady state ... thrombin and PAI-1 These findings leave a role for TM open in altering the initial binding step between thrombin and PAI-1 or in changing the ability of thrombin to catalyze subsequent steps that are ... solulin Solulin lacks the transmembrane domain and does not contain chondroitin sulphate, which might have an additional heparin-like effect on the thrombin/PAI-1 interaction [19] In this way,...

Ngày tải lên: 23/03/2014, 17:21

10 486 0
Báo cáo y học: "A steady state analysis indicates that negative feedback regulation of PTP1B by Akt elicits bistability in insulin-stimulated GLUT4 translocation" potx

Báo cáo y học: "A steady state analysis indicates that negative feedback regulation of PTP1B by Akt elicits bistability in insulin-stimulated GLUT4 translocation" potx

... translocation at various concentrations of IRS-1 and Akt respectively Such an increase or decrease in the half-maximal concentration of insulin characterizes the decrease and increase in insulin ... concentration (Fig 5A) and by changing the percentage feedback at a fixed Akt concentration (Fig 5B) As shown in Fig 5A, increase in Akt concentration amplifies the signal by maintaining bistable ... values on insulin-stimulated GLUT4 translocation, we have analyzed the performance of insulin signaling pathway to variations in key parameter values such as, dissociation constant and Michaelis-Menten...

Ngày tải lên: 13/08/2014, 22:22

16 254 0
Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

... Churchill–Bernstein: ae ¼ Rea ¼ qa ua De insulation la A: 10Þ Pra ¼ Cpa la ka A: 11Þ The evaluation of the radiative heat exchange between the cover of the external thermal insulation of the gasifier and ... Ahmad AA, Zawawi NA, Kasim FH, Inayat A Assessing the gasification performance of biomass: a review on biomass gasification process conditions, optimization and economic evaluation Renew Sustain ... mass flows) and the gasifying air temperature at the inlet of the reactor (changing the opening of the bypass valve of the air preheater) As stated above, the thermodynamic data of each stream...

Ngày tải lên: 01/08/2016, 09:29

12 221 0
Nitrogen Dynamics and Biomass Production in a Vertical Flow Constructed Wetland Cultivated with Forage Rice and their Mathematical Modeling

Nitrogen Dynamics and Biomass Production in a Vertical Flow Constructed Wetland Cultivated with Forage Rice and their Mathematical Modeling

... the leaf area Roughly, the plant height increased until 120 days after transplantation, and thereafter a constant height was maintained in every case The leaf area index (LAI), however, increased ... N., Sato, H., Hirasawa, H., Takadate, M., Tamura, K., Ando, I., Ishii, T., Iida, S., Maeda, H., Aoki, N., Ideta, O., Hirabayashi, H., and Ohta, H (2003) A new rice variety for whole-crop silage ... experimental and model analysis approaches MATERIALS AND METHODS Pot Experiment A series of experiments was performed at an open-air experimental station located in Ibaraki Prefecture, Japan Figure...

Ngày tải lên: 05/09/2013, 09:38

16 583 1
Tài liệu Maintaining State in a Web Application pptx

Tài liệu Maintaining State in a Web Application pptx

... building a Web site that a user can order products from, store their shopping cart in the database Using a DataGrid Control to Access a Database A DataGrid allows you to access rows in a database ... create a DataSet object You use a DataSet object to store a local copy of the information stored in the database A DataSet object can represent database structures such as tables, rows, and columns ... online documentation Storing Information using the Database If you have a large amount of information to store about a user, store it in the database rather than the Session object For example,...

Ngày tải lên: 24/12/2013, 01:17

22 413 0
PHÂN TÍCH báo cáo NGHIÊN cứu state owned enterprises (SOEs) in vietnam perceptions of strategic direction for a society in transition

PHÂN TÍCH báo cáo NGHIÊN cứu state owned enterprises (SOEs) in vietnam perceptions of strategic direction for a society in transition

... tài: State- owned enterprises (SOEs) in Vietnam Perceptions strategic direction for a society in transition” Tạm dịch: Nhóm - Lớp Đêm - K22 Tiểu luận môn PPNCKH GVHD: TS Đinh Thái Hoàng date]TiTi6 ... lãnh đạo vấn, ý định cấu lại doanh nghiệp họ kinh tế cạnh tranh toàn cầu kinh tế Việt Nam ch a hoàn toàn mở c a để doanh nghiệp cạnh tranh cách tự do, bình đảng Thứ hai, tác giả tiếp tục phân tích ... rào cản: - Kinh nghiệm người vấn: Tâm lý kinh nghiệm người vấn đóng vai trò quan trọng Có trường hợp người vấn khai thác hết thông tin khó để nhận biết kiến chủ quan người vấn Ngoài ra, gặp gỡ...

Ngày tải lên: 24/12/2013, 23:11

18 678 2
Tài liệu Republican Legal Theory The History, Constitution and Purposes of Law in a Free State ppt

Tài liệu Republican Legal Theory The History, Constitution and Purposes of Law in a Free State ppt

... judiciary, and a general system of checks and balances, to protect public liberty against corruption and to safeguard the equal individual rights of all citizens against each other and against the state ... sides in the shallow academic culture wars had approached republican doctrine in the spirit of litigants, quarrying history for partisan advantage, without real interest in learning from the past ... Cromwell’s state seals,27 as the American Commonwealth of Pennsylvania 18 Republican Legal Theory was styled in Latin “Respublica” in all its early law reports,28 the word “commonwealth” came to be associated...

Ngày tải lên: 18/02/2014, 11:20

211 750 1
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

... spectrophotometric assays Initial velocities obtained from varying glutamine (A) Glutaminase (circles) and CTP synthesis (squares) Open symbols represent data obtained from the assay of glutamate production ... substrate concentration and Km is the HenriMichaelis Menten constant Partial inhibition of the glutaminase activity induced by GTP was analysed using a modication of the equation by LiCata and Allewell ... (min) Fig Isothermal titration calorimetry of the glutaminase activity of L lactis CTP synthase (A) Enthalpogram showing the recording of steady- state rates for the hydrolysis of glutamine at increasing...

Ngày tải lên: 21/02/2014, 15:20

8 699 0
Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx

Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx

... usually begin as operators of conventional dairies that go through what can be a challenging and costly transition process Many changes in such areas as animal husbandry, land and crop management, ... scope and the depth of data supporting the analyses This study addresses these limitations, taking advantage of a unique nationwide data set of organic and conventional dairies Data Data used in ... organic approach These areas have a resource base that may be more conducive to farms adopting the organic approach because of access to high quality pastures and the ability to manage pasture as...

Ngày tải lên: 22/02/2014, 05:20

30 662 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx

Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx

... estado de São Paulo, Brasil: estudio poblacional Palabras clave 27 Organização Pan-Americana da Saúde Saúde nas Américas: 2007 Washington, D.C.: OPAS; 2007 (Scientific Publication No 662) 28 Wang ... functioning scales Depression/ anxiety made a considerable impact as well, with large differences in mean score, particularly affecting mental health and role-emotional Arthritis and backpain had ... Medical Sciences of the State University of Campinas, Campinas, São Paulo RESULTS The data analyzed came from a total of 958 individuals—929 males and 029 females 60 years of age or more The mean...

Ngày tải lên: 05/03/2014, 21:20

8 705 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in...

Ngày tải lên: 06/03/2014, 01:20

11 450 0
IN A PERFECT OCEAN THE STATE OF FISHERIES AND ECOSYSTEMS IN THE NORTH ATLANTIC OCEAN pdf

IN A PERFECT OCEAN THE STATE OF FISHERIES AND ECOSYSTEMS IN THE NORTH ATLANTIC OCEAN pdf

... populations in this region are also in a poor state and, even though in 1992 groundfish abundance was at its lowest in 30 years, overall fishing effort in the area was still increasing in the late ... river, each measuring up to an astounding 18 feet, bigger than nearly all the sharks and rivaling many marine N006_Pauly_Ch_1 10 10/22/02 2:18 PM Page 10 In a Perfect Ocean mammals Salmon, ranging ... hope that through this book, readers will realize the importance of maintaining and safeguarding marine ecosystems, which are in many ways as indispensable to our well-being as the terrestrial ecosystems...

Ngày tải lên: 06/03/2014, 18:21

206 581 0
CLEANER PRODUCTION AUDIT IN THE PULP AND PAPER INDUSTRY: A CASE STUDY IN VIETNAM doc

CLEANER PRODUCTION AUDIT IN THE PULP AND PAPER INDUSTRY: A CASE STUDY IN VIETNAM doc

... Output Activity - Cooking - Washing - Beating - Paper Machine 1, - Paper Machine - Steam Boiler (estimated) - Floor Cleaning - Beater Cleaning - Hand Washing - Leaking Water Total Quantity (m3/day) ... consuming water are washing, diluting pulp before pumped to beaters, beating and paper making Actually, in this mill beating unit operation is the process combining beating and washing It was found ... the paper machines including washing wire and washing blanket was measured Then the water consumption for paper machine was calculated from flow rate, paper machine velocity and product amount...

Ngày tải lên: 09/03/2014, 01:20

98 769 0
Báo cáo khoa học: Modeling of ATP–ADP steady-state exchange rate mediated by the adenine nucleotide translocase in isolated mitochondria potx

Báo cáo khoa học: Modeling of ATP–ADP steady-state exchange rate mediated by the adenine nucleotide translocase in isolated mitochondria potx

... al steady- state phosphorylation rate than the increase of electric potential and corresponding increase in ATP ADP steady- state exchange rate mediated by the ANT As also seen in Fig 3, the calculated ... Titration of ATPADP steady- state exchange rate mediated by ANT with cATR and correlation with DWm (A) ATPADP steadystate exchange rate mediated by ANT determined as a function of cATR concentration ... constant of ATP and ANT Dissociation constant of ADP and ANT Parameters of ANT electrostatic prole Correction factor characterizing activity of ATP synthase in a particular mitochondrial preparation...

Ngày tải lên: 16/03/2014, 00:20

14 445 0
w