... DNA A 74-mer ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular ssDNA (New England BioLabs, ... Natl Acad Sci USA 94, 11221–11226 12 Hong EL, Shinohara A & Bishop DK (2001) Saccharomyces cerevisiae Dmc1 protein promotes renaturation of single-strand DNA (ssDNA) and assimilation of ssDNA into ... relative DNA- binding activities were assessed by comparing the amounts of DNA remaining at the original positions (ssDNA and dsDNA are indicated by filled and open arrowheads in Fig 5) and the amounts...
Ngày tải lên: 06/03/2014, 09:22
... formal uncertainty analysis in EPA s RIAs Status of EPA Uncertainty Analysis in Recent RIA s EPA s recent RIAs acknowledge the NRC critique of its uncertainty analysis in the RIA discussion of ... Uncertainty Analysis in Developing a Concentration-Response Function for Estimating Health Benefits for Recent NAAQS Rules Ozone NAAQS Lead NAAQS NO2 NAAQS SO2 NAAQS Primary Analysis Mean Based on Effect Estimate ... Treatment of Uncertainty in EPA s Analysis of Air Pollution Rules: A Status Report Arthur G Fraas Abstract An understanding of the uncertainty in benefit and cost estimates is a critical part of...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo y học: "A comparative analysis of DNA methylation across human embryonic stem cell lines" docx
... novel approach to measure allele-specific expression by Page of 12 combining BS-seq and RNA-seq data from the same sample RNA-seq provides digital measurement of transcription at single base resolution, ... 29:3506-3512 Law JA, Jacobsen SE: Establishing, maintaining and modifying DNA methylation patterns in plants and animals Nat Rev Genet 2010, 11:204-220 Athanasiadou R, de Sousa D, Myant K, Merusi C, Stancheva ... systematic analysis of the correlation between changes in methylation status at binding sites and the resulting changes in gene expression across the three HESC lines The expectation was that...
Ngày tải lên: 09/08/2014, 23:20
Hegel’s analysis of mind and world - the Science of Logic
... judging agents as a set of causal relationships holding among the various “accidents” of the substance – that is, that skeptical realism and subjective idealism must ultimately yield to some form of ... post-Kantian period in Germany as to whether all forms of rationalist metaphysics necessarily lead to such monist substantialism Hegel s response was to argue that Jacobi had gotten that part ... “logical,” that is, to be an analysis of the ways in which certain typical stances toward metaphysics in the past have committed themselves to certain positions, such that in the process of actualizing...
Ngày tải lên: 01/11/2013, 08:20
Báo cáo hóa học: " Autoregressive Modeling and Feature Analysis of DNA Sequences" pot
... through techniques such as phase analysis, two- and three-dimensional sequence path analysis, and statistical analysis The signal processing of symbolic sequences has also been addressed in [35, 36] ... of analyses In the first analysis, the residual error variance of DNA sequences was used as a measure to indicate the “goodness” of the AR fit In other words, AR models of various DNA segments were ... analysis techniques based on correlation functions and DSP-based methods is presented in Section The motivation for the use of parametric spectral analysis methods for DNA analysis and its various...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo y học: "New classification of HLA-DRB1 alleles in rheumatoid arthritis susceptibility: a combined analysis of worldwide samples" docx
... in terms of RA susceptibility across various Caucasoid and non-Caucasoid population samples Materials and methods Selection process of case and control population samples RA cases and healthy ... Voulgari PV, Boki KA, Papasteriades CA, Drosos AA: Shared epitopes and rheumatoid arthritis: disease associations in Greece and meta -analysis of Mediterranean European populations Semin Arthritis ... cases and controls across the various Caucasoid and non-Caucasoid population samples and overall effect estimation This figure provides a summary meta -analysis of allele carrier frequencies according...
Ngày tải lên: 09/08/2014, 10:23
Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants
... etc Among the various applications, the CE applications in DNA analysis and monitoring of pollutants are of significant importance 1.3.1 CE Application in DNA Analysis DNA separation by CE has ... analysis of various pollutants at trace level CE is found to be a versatile analytical tool for the analysis of DNA as well as pollutants Combination of DNA analysis and environmental pollutant monitoring ... kinds of environmental water samples The portable CE-CCD system has advantages such as simplicity, cost effectiveness and miniaturization, and therefore has great potential for on-site analysis of...
Ngày tải lên: 14/09/2015, 11:40
Báo cáo y học: " Allele-specific copy number analysis of tumor samples with aneuploidy and tumor heterogeneity" ppt
... Ms Karolina Edlund for expert assistance in DNA isolation and analysis as well as Mrs Maria Rydåker at the Uppsala Array Platform for the SNP array analysis Mrs Lena Lenhammar expertly assisted ... TAPS and DNA ploidy analysis indicates that TAPS is highly suitable for analyzing tumor samples Limitations TAPS has been developed and validated for SNP array data from Affymetrix 500K and SNP ... visualization of chromosomal aberrations in tumor samples A scatter plot of the average Log-ratio and the Allelic Imbalance Ratio of all segments in a sample reveals the aberrations present A) ...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: "inferring steady state single-cell gene expression distributions from analysis of mesoscopic samples" docx
... (GGACTTCGAGCAAGAGATGG, AGGAAGGAAGGCTGGAAGAG); ATP5L, (CAAGGTTGAGCTGGTTCCTC, CACCAAACCATTCAGCACAG); GAPDH, (GAGTCAACGGATTTGGTC GT, GATCTCGCTCCTGGAAGATG); GNAS, (TGAACGTGCCTGACTTTGAC, TCCACCTGGAACTTGGTCTC); ... analysis of samples of mesoscopic size In many ways, this situation is analogous to one in statistical mechanics and thermodynamics While we understand that the Ideal Gas Law describes gas dynamics ... within a cell as a Poisson random variable and derive an analytical solution that captures the randomness in gene expression, manifested as an increase in measured biological variability as we...
Ngày tải lên: 14/08/2014, 17:22
Báo cáo y học: " Structural analysis of bacteriophage T4 DNA replication: a review in the Virology Journal series on bacteriophage T4 and its relatives" pptx
... gp43 DNA polymerase simultaneously, similar to most prokaryotes Okazaki fragments are initiated stochastically every few thousand bases in prokaryotes (eukaryotes have slower pace polymerases with ... helicase is inhibited In the absence of gp32 ssb protein, the addition of gp41 helicase improves the rate of DNA synthesis but displays a significant lag prior to reaching maximal DNA synthesis ... Advanced Light Source (ALS) at Lawrence Berkeley National Labs (LBNL), and the Advanced Photon Source (APS) at Argonne National Labs (ANL) These advances have transformed crystallography to a...
Ngày tải lên: 11/08/2014, 21:21
A CRITICAL DISCOURSE ANALYSIS OF MARTIN LUTHER KING’S SPEECH ‘BEYOND VIETNAM – a TIME TO BREAK SILENCE’
... Material Material Behavioral Material Material Relational Relational Existential Material Material Material Material Material Mental Material Material Material Behavioral Material Material Material ... is Relational Relational Material Relational Carrier has become Relational Sayer Sayer Sayer Sayer Carrier Goal speak am not speaking am not speaking am speaking is is summed up Verbal Verbal ... easily assume move seem are have found Mental Material Material Relational Material Relational Relational Material Mental Material Relational Relational Mental must speak must speak must speak must...
Ngày tải lên: 07/09/2013, 12:58
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... PERSPECTIVE OF D .A prescribed required proclaim state years of sabbatical years of rest ultimate/ eventual final attain reach persistent constant swift fast anew again edifice of character set of ... the speech and thus provide promisingly interesting findings for the analysis We also resort to a series of related articles and news analysis in English to ensure an all-rounded analysis on ... presidential speeches The 2004 inaugural address employs a rather good deal of words in their formal form as a means of attaining solemnity as well as the leadership of the speaker Here is an account of...
Ngày tải lên: 18/12/2013, 10:08
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq
... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A ! N # 7 # ? ... # * # A % ) % #) +D % - ) # A # B - B - 4F +D % - ) +D A +D D %+D) 6 # # # 6 + ; * # ' B %8 A 4FF &) **+ +D #0 D # - +D +D % ) * * B - +D A +D +D * # # 7 6 < +D +D 6 I < ' %8 A ! 60 A 4FF :C)...
Ngày tải lên: 29/01/2014, 00:23
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... significant changes as a consequence of a- synuclein overexpression or as a result of the association of dopamine treatment with a- synuclein overexpression (Fig 3B) The same analysis performed on all ... Pro transmission scanner (Epson, Nagano, Japan) and analyzed with imagemaster 2d platinum software, version 5.0 (GE Healthcare) Spots were detected automatically by the software and manually refined; ... experimental parkinsonism Proc Natl Acad Sci USA 104, 1977–1982 37 Werner CJ, Heyny-von Haussen R, Mall G & Wolf S (2008) Proteome analysis of human substantia nigra in Parkinson s disease Proteome Sci...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... 32P-labeled Htelo (lanes and 4), dsHtelo (lanes and 6) or ssDNA S (lanes and 2) The structures of DNAs used as probes are indicated above each lane The DNA protein complexes were resolved by 6% PAGE ... and visualized by autoradiography acids, was expressed in Escherichia coli as proteins fused to glutathione S- transferase (GST) and purified using glutathione agarose 32P-labeled ETS-1 was first ... EWS for binding to G-quadruplex DNA (A) EMSA was performed with EWS (lanes and 4) and 32P-labeled ETS-1 (lanes and 4) or ssDNA L (lanes and 2) (B) EMSA was performed with EWS (lanes 2, and 6) and...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc
... farmers and ranchers to receive payments for carbon offsets EPA s analysis indicates that in 2020 agricultural lands would supply 70 million tons of CO2e offsets through changes in tillage practices, ... rising to $20 billion per year in 2050 It s important to note that EPA s analysis includes revenue generated from forest management offsets while USDA s does not USDA s analysis strongly suggests ... provides significant opportunities to offset increased costs through carbon sequestration activities Our analysis does not assess the change in farm income due to the Renewable Electricity Standard...
Ngày tải lên: 21/02/2014, 01:20
Tài liệu a budgetary analysis of nasa s new vision for space exploration docx
Ngày tải lên: 23/02/2014, 04:20
Báo cáo khoa học: "A System for Real-time Twitter Sentiment Analysis of 2012 U.S" pdf
... automated real-time sentiment analysis of this user-generated data can provide fast indications of changes in opinion, showing for example how an audience reacts to particular candidate s statements ... and Visualization We designed an Ajax-based HTML dashboard 118 (Figure 3) to display volume and sentiment by candidate as well as trending words and system statistics The dashboard pulls updated ... modules and assemble them into a real-time processing pipeline Streams applications are highly scalable so we can adjust our system to handle higher volume of data by adding more servers and by distributing...
Ngày tải lên: 16/03/2014, 20:20