... to thank the Director of the ONM (Office of National Meteorology of Algiers), for making available the database of solar radiation data for different sites, and Prof A Guessoum (Head of Signal ... S .A (2006) An adaptive wavelet-network model for forecasting daily total solar radiation, Applied Energy, 83, 705–722 Mellit, A (2007) An ANFIS-based forecasting for solar radiation data from sunshine ... instead of the average H as often used The data used in this study was collected from meteorological stations of Algeria Journal of Physical Science, Vol 18(2), 15–35, 2007 17 DATA SET The database...
Ngày tải lên: 07/08/2014, 14:20
... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac ... primers for MCoTI-II gene cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg...
Ngày tải lên: 12/02/2014, 10:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... molecular-chaperone activity of Artemia p26, a small heat shock /a- crystallin protein Eur J Biochem 243, 225–232 58 Liang, P., Amons, R., Clegg, J.S & MacRae, T.H (1997) Molecular characterization of a small heat...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... computational meshes obtained is acceptable These generated meshes have been used as the input of a 3D computational fluid dynamics software for turbulent compressible atmospheric flows and air quality...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo khoa học: "Automatic Induction of a CCG Grammar for Turkish" pptx
... Combinatory Categorial Grammar Ph.D thesis, University of Edinburgh Yehoshua Bar-Hillel, C Gaifman, and E Shamir 1964 On categorial and phrase structure grammars In Language and Information ed Bar-Hillel, ... Head-driven Statistical Models for Natural Language Parsing Ph.D thesis, University of Pennsylvania Julia Hockenmaier 2003 Data Models for statistical parsing with Combinatory Categorial Grammar Ph.D ... there are many smallscale treebanks being developed for understudied languages, it is important to explore ways to boost the performances of statistical parsers from small amounts of human labeled...
Ngày tải lên: 17/03/2014, 06:20
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of §2 is translated ... syntactic coverage of English grammars In DARPA, editor Proceedings of the Fourth Darpa Speech and Natural Language Workshop, pages 306-311, Pacific Grove, California, February, Morgan Kaufmann ... divergent parses.' Last of all, the XML format into which we translate the parses is an open exchange format It is an important asset for portability and reuse of parsing technolgy E.g for question answering...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf
... TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT ... 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites ... N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA...
Ngày tải lên: 23/03/2014, 13:20
Source investigation of a small event using empirical Green’s functions and simulated annealing ppt
... active area on the fault This gives us values of the average total slip of between 0.1 and cm and a stress drop of between I and 10 bar for a rise time equal to At, and a stress drop that can reach ... scale For each of the two possible fault planes, the active fracture area has a different shape Fig shows a rupture propagation towards the north-north-east for the two fault planes The shape and ... value These values are compatible with a hypothesis of self-similar scaling, even for small earthquakes (Aki & Richards 1980), but we can not overrule a possible breaking of scaling laws for small...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot
... analogs with a- Syn and some amino acids (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h The a- Syn alone sample was as a control The concentration of a- Syn was 200 lM and ... assay The concentration of a- Syn was 200 lM and the fibrillization of a- Syn alone was as a comparison Data were represented as means ± SEM (F) Atomic force microscopic images of a- Syn fibrils a- Syn ... aggregate The MTT reduction ability of the cell culture after addition of a- Syn or DA was also measured as a comparison The concentration of all a- Syn forms for the MTT assay was 10 lM Data represented...
Ngày tải lên: 23/03/2014, 15:20
Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt
... rules that are shared among lexical items, as well as by the declarative nature of the grammar formalism itself, 6The example is merely meant to be indicative of the syntax for and operation of lexical ... decidability of that f{,rmalism [Kaplan and Bresnan, 83] Off-line parsability req.ires that the context-free "skeleton" of the grammar allows no trivial cyclic derivations of the form A ~ A 2.3 Mathematical ... syntactic, and semantic information, and one operation unification on this representation By way of example, we present a trivial grammar for a fragment of English with a lexicon associating words...
Ngày tải lên: 24/03/2014, 01:21
Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc
... Table I Baseline data for the 58 smear-negative patients (continued) Characteristic Adenopathy Infiltrate and adenopathy Pleural effusion/thickening and infiltrates Pleural effusion and adenopathy ... 55probable TB cases (3 probable TB cases (3 ‡ had military patterns on had miliary patterns on CXR, and had high ADA CXR, and had high ADA levels in pleural effusion, all levels in pleural effusion, ... weight gain after weeks of TB treatment and then defaulted, had died at a secondary hospital weeks later Another patient defaulted TB medication and died weeks later The outcome of the third case...
Ngày tải lên: 29/03/2014, 03:20
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed ... were among the "inventoried" assays available from ABI, and are described in Table cDNA synthesis, preparation of samples for TLDA assay and measurements of RNA concentration were performed as ... 10.1186/1479-5876-8-51 Cite this article as: Arai et al., Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx
... a parabolic manner and was modeled as A( θ) = a( 40 - θ)2 + b(40 - θ) + A4 0, (11) where A4 0 is the value of A at 40° of knee flexion, and a and b are constants that need to be identified for each ... velocity of motor scaling factor for force at 40° of knee flexion scaling factor to account for force at each knee flexion angle scaling factor to account for force at each knee flexion angle knee ... FES are probably complex One way to assist the search for the optimal pattern is to use mathematical models that can predict forces accurately to a range of physiological conditions and stimulation...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Rehabilitation robotics: pilot trial of a spatial extension for MIT-Manus" pdf
... MIT-MANUS to allow spatial movements Note that in the standalone fashion it can be operated at any angle to the horizontal and vertical planes with adjustable handle positions Page 12 of 15 (page ... Additional Vertical Anti-Gravity Training at the Burke Rehabilitation Hospital Graduates from Planar Robot Protocol Receiving Additional Vertical Anti-Gravity Training at the Burke Rehabilitation ... application of robotics as a therapy aid, and in particular a tool for therapists We foresee robots and computers as supporting and enhancing the productivity of clinicians in their efforts to facilitate...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt
... inequalities Carpathian J Math 24, 139–148 (2008) He, BS, Yang, ZH, Yuan, XM: An approximate proximal-extragradient type method for monotone variational inequalities J Math Anal Appl 300, 362–374 ... 833, Taiwan 3Department of Applied Mathematics, Chung Yuan Christian University, Chung Li 32023, Taiwan 4Center for General Education, Kaohsiung Medical University, Kaohsiung 807, Taiwan Authors’ ... nonlinear variational problems Springer, New York (1984) Iusem, AN: An iterative algorithm for the variational inequality problem Comput Appl Math 13, 103–114 (1994) Yao, JC: Variational inequalities...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx
... Barolli L, Ikeda M, De Marco G, Durresi A, Xhafa F (2009) Performance Analysis of OLSR and BATMAN Protocols Considering Link Quality Parameter Proc of IEEE AINA-2009 307–314 11 Kulla E, Ikeda ... packet size, LQWS, and topology setting function We can save the data for these parameters in a text file and can Page of 14 Hiyama et al Human-centric Computing and Information Sciences 2011, ... MT scheme, the MAC filtering routines are not enabled We collected data for two metrics: delay and jitter These data are Page of 14 Hiyama et al Human-centric Computing and Information Sciences...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo hóa học: " Research Article Experimental Characterization of a UWB Channel for Body Area Networks" potx
... load Antenna at free space Antenna at head Antenna at chest Antenna at thigh Figure 5: Measured return loss of the antenna (b) Non-Line -of- Sight The transmission between the TX and RX antennas ... antennas placed near the human are characterized The frequency- and distancedependent characteristics of a UWB channel are analyzed in this paper, where an NLOS channel is shown to have larger path ... include LOS and NLOS channel measurement, using a TX antenna placed on the human body and a separate RX antenna located externally Section introduces EURASIP Journal on Wireless Communications and Networking...
Ngày tải lên: 21/06/2014, 07:20