... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve ... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... followed by a preposition, as in the last paraphrase We used the Amazon Mechanical Turk Web service5 to recruit human subjects, and we instructed them to propose at least three paraphrasing verbs...
Ngày tải lên: 08/03/2014, 01:20
... and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the Internet ... postdated the Internet revolution by more than a decade, the data offer a unique opportunity to assess the impact of the Internet on the way Americans meet their romantic partners The fact that Americans ... survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and Hispanics are the two groups that contribute most to racial and ethnic intermarriage in the US...
Ngày tải lên: 15/03/2014, 21:20
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also...
Ngày tải lên: 15/05/2015, 00:37
assessing a customer service model in the financial services industry
... not to call at work, and (c) after they have retained an attorney A search of the literature indicated that contacting customers after they have retained an attorney was a frequent infraction ... vs Account Control Tech (as cited in “ACA International’s Guide,” 200 5a) , a collection agency repeatedly contacted a customer after it was warned that the customer had retained an attorney; and ... employees and management applied the program in their ordinary workday The results will assist XYZ Financial Services and the financial services industry as a whole in providing excellent customer service...
Ngày tải lên: 03/06/2014, 00:52
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... in the IPM plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small ... Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by TOT trainees in their own provinces using a standard ... bait was very attractive to these two species of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and...
Ngày tải lên: 21/06/2014, 05:20
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the use of weaver ants in cashew ... in the TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, ... in the same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data...
Ngày tải lên: 21/06/2014, 06:20
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
... Vietnam, there are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly ... cashew farming status Based on this baseline survey, the majority of cashew growers were small holders, having about of orchards with the average tree age being years (for grafted materials) and ... project Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by TOT trainees in their own provinces using a standard questionnaire...
Ngày tải lên: 21/06/2014, 06:20
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
... make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages and disadvantages of using ... strategy (weaver ants, pruning and light-trapping) to manage the branch borer that has been one of the major concerns by all cashew growers in Vietnam He has already passed this knowledge to IAS project ... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
... base, and each larva excavated a chamber in which the calcareous pupal cell was formed from the excretions of the larva Pupation took place late in the year The pupa is about 35 mm long, creamy-white, ... because of weaver ant boundary fights, the abundance of weaver ants was < 40% in the IPM plot, which was low The average damage level for each of the main pests was greater in the IPM plot than ... ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much higher and the yield was much lower in the IPM plot than...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
... showed that all the TOT trainees (56 in the first year and 56 in the second year) successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training ... methods, and they were very interested in the field practical All the master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was ... practicals, and (2) all the master trainers did their best to pass their knowledge to the TOT trainees 1.4 Graduation examination of TOT trainees Graduation examinations were conducted at the...
Ngày tải lên: 21/06/2014, 06:20
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
... Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive ... weaver ants, and would use weaver ants and tell their friends and other farmers to use the ants Farmers’ knowledge about insect pests, diseases and their natural enemies as well as general farming ... each Sub-PPD has to make a contract with the IAS To this, they have to fill in a complicated paper work as required by IAS administration) (Table 1), and (2) TOT trainers in the Sub-PPDs of Ba...
Ngày tải lên: 21/06/2014, 06:20
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
... (Helopeltis antonii), that caused the majority of damage on flushing shoots The most important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect ... since the project started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration ... cashew development as a national priority Productivity of cashew has been increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals and the...
Ngày tải lên: 21/06/2014, 06:20
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... doctor, a score for each construct in the TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales ... Thomas was funded by the Wellcome Trust (GR0673790AIA) Bernard Croal was supported by a grant from Grampian Endowments Jeremy Grimshaw holds a Canada Research Chair in Health Knowledge Transfer and ... correlated for all the tests (Table 3) There was no evidence that perceived behavioural control was correlated with any of the other measures Multiple linear regression analyses demonstrated that attitude...
Ngày tải lên: 10/08/2014, 10:23
BÀI LUẬN TIẾNG ANH HAY nuclear energy write about the pros and cons of using nuclear energy as a energy source
Ngày tải lên: 20/08/2015, 00:37
Diffusion of internet adoption a study of the relationship between innovativeness, the attitude of teachers toward using the internet, and internet use
... before adopting Late Majority The conservative or skeptical latter half of the mainstream They accept innovation late in the game, once the change has already become well-established among the majority ... to adopter categories, critical mass takes place at the point where the early majority begins the adoption process Moore’s (1991) observation of critical mass reveals that as an innovation passes ... Internet Attitude Analysis of Variance 197 K-l Age and Internet Attitude Analysis of Variance 197 K-12 Subject and Internet Attitude Analysis of Variance 197 K-13 Grade Level and Internet Attitude...
Ngày tải lên: 18/04/2017, 23:35
Tài liệu Understanding the Internet as an Infrastructure docx
... approach are that the application has to arrange for the data in the cookie to be transmitted over the Web as part of every HTTP request so that the Web server can access it The application also ... time the request was submitted, even if it was the same code each time With the advent of the NET platform, Microsoft updated the Active Server Pages framework and created ASP.NET The main features ... mixing application code and HTML caused readability and maintenance issues; and performance was not always what it could be because Active Server Pages had to interpret application code in an HTML...
Ngày tải lên: 15/12/2013, 00:15
Using eliciting question as a technique to teach english to 11th form pupils
... teaching There are other reasons for choosing the study, but the above reasons are the main ones that encourage the author to choose the thesis: Using eliciting questions as a technique to teach ... this approach in their teaching But the fact is that they have not successfully applied this approach Half of them say that they always let their pupils make questions communicatively in class and ... example, when teachers ask students about the opinions, experiences, or ideas about how to apply what is in a text that the class has read, the questions are referential ones These are the types of...
Ngày tải lên: 27/12/2013, 20:26
Tài liệu Module 13: Using the Microsoft Exchange Server Event Service pptx
... fldrOutbox As Variant fldrTarget As Variant messageitem As Variant linkitem As Variant escalationMessage As Variant Dim escalationdate As String Dim modifiedstatus As String Dim ManagerSMTP As String ... Options dialog box appears Click the Other tab and then click Advanced Options The Advanced Options dialog box appears Click Add-In Manager The Add-In Manager dialog box appears Select the Server ... permissions match those of basic Exchange Server components, such as the directory service and the information store This means that the agent has the same broad powers on the system as Exchange Server...
Ngày tải lên: 17/01/2014, 08:20