sell using the internet as a sales tool

Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve ... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... (container, content, equative, material, measure, topic, type) For example, exam anxiety is classified as effect and therefore as CAUSALITY, and blue book is property and therefore also PARTICIPANT...

Ngày tải lên: 08/03/2014, 01:20

9 392 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

... and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the Internet ... postdated the Internet revolution by more than a decade, the data offer a unique opportunity to assess the impact of the Internet on the way Americans meet their romantic partners The fact that Americans ... survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and Hispanics are the two groups that contribute most to racial and ethnic intermarriage in the US...

Ngày tải lên: 15/03/2014, 21:20

50 471 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also...

Ngày tải lên: 15/05/2015, 00:37

58 265 0
Báo cáo y học: "Assessing post-traumatic stress disorder in South African adolescents: using the child and adolescent trauma survey (CATS) as a screening tool" docx

Báo cáo y học: "Assessing post-traumatic stress disorder in South African adolescents: using the child and adolescent trauma survey (CATS) as a screening tool" docx

... traumatic events was low between the measures and participants were more likely to endorse a trauma on the CATS than on the K-SADS This may be attributable to the fact that more vicarious traumatisation ... significances for categorical data Cohen's kappa coefficients (K) were used to measure the level of agreement between the measures As initial analysis revealed a statistically significant difference ... Mental Health 2000, 12:38-44 American Academy of Child and Adolescent Psychiatry: Practice parameters for the psychiatric assessment of children and adolescents Journal of the American Academy...

Ngày tải lên: 08/08/2014, 21:20

10 668 0
báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

... information losses in the statistical analysis A total sample size of 210 subjects was therefore considered adequate The retest sample was selected at random as a sub sample from the scaling and validation ... questionnaire was calculated Concordance between classification criteria was assessed by inter-rater agreement statistics (kappa) and a Chi-square test All statistical calculations were performed using ... Convergent validity: The degree of concordance between the GAD-7 scale and the Hamilton Anxiety Scale (HAM -A) , the Hospital Anxiety and Depression Scale (HADS, anxiety domain), and the WHO-DAS II disability...

Ngày tải lên: 18/06/2014, 19:20

11 537 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

... sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data For example, a user send their data to a multicast address and the ... of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the fiber, very affordable The ... receive therapy Our scenario could work in several conditions For example, a therapist at one location may want an opinion about the patient from a colleague at another location or, perhaps, the therapist...

Ngày tải lên: 19/06/2014, 10:20

10 450 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

... in the IPM plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small ... Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by TOT trainees in their own provinces using a standard ... bait was very attractive to these two species of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and...

Ngày tải lên: 21/06/2014, 05:20

10 553 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

... include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the use of weaver ants in cashew ... in the TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, ... in the same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data...

Ngày tải lên: 21/06/2014, 06:20

12 532 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf

Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf

... Vietnam, there are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly ... cashew farming status Based on this baseline survey, the majority of cashew growers were small holders, having about of orchards with the average tree age being years (for grafted materials) and ... project Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by TOT trainees in their own provinces using a standard questionnaire...

Ngày tải lên: 21/06/2014, 06:20

7 404 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

... make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages and disadvantages of using ... strategy (weaver ants, pruning and light-trapping) to manage the branch borer that has been one of the major concerns by all cashew growers in Vietnam He has already passed this knowledge to IAS project ... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals...

Ngày tải lên: 21/06/2014, 06:20

24 454 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

... base, and each larva excavated a chamber in which the calcareous pupal cell was formed from the excretions of the larva Pupation took place late in the year The pupa is about 35 mm long, creamy-white, ... because of weaver ant boundary fights, the abundance of weaver ants was < 40% in the IPM plot, which was low The average damage level for each of the main pests was greater in the IPM plot than ... ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much higher and the yield was much lower in the IPM plot than...

Ngày tải lên: 21/06/2014, 06:20

26 492 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

... showed that all the TOT trainees (56 in the first year and 56 in the second year) successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training ... methods, and they were very interested in the field practical All the master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was ... practicals, and (2) all the master trainers did their best to pass their knowledge to the TOT trainees 1.4 Graduation examination of TOT trainees Graduation examinations were conducted at the...

Ngày tải lên: 21/06/2014, 06:20

10 304 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

... Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive ... weaver ants, and would use weaver ants and tell their friends and other farmers to use the ants Farmers’ knowledge about insect pests, diseases and their natural enemies as well as general farming ... each Sub-PPD has to make a contract with the IAS To this, they have to fill in a complicated paper work as required by IAS administration) (Table 1), and (2) TOT trainers in the Sub-PPDs of Ba...

Ngày tải lên: 21/06/2014, 06:20

37 395 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

... (Helopeltis antonii), that caused the majority of damage on flushing shoots The most important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect ... since the project started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration ... cashew development as a national priority Productivity of cashew has been increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals and the...

Ngày tải lên: 21/06/2014, 06:20

10 327 1
Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt

Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt

... Health (AYMH) scale as a screening tool for CMDs among Arabic-speaking youth The AYMH scale was developed as part of a large community-based participatory intervention to improve the mental health ... general, and anxiety and depression specifically, among Arab children and adolescents in the MENA region The validation revealed that the AYMH scale has reasonably good construct validity and ... was bored and I had nothing to 17 During the last week I was having thoughts of death 18 During the last week I was feeling emotionally drained 19 During the last week my heart was beating fast...

Ngày tải lên: 13/08/2014, 18:21

7 386 0
Diffusion of internet adoption a study of the relationship between innovativeness, the attitude of teachers toward using the internet, and internet use

Diffusion of internet adoption a study of the relationship between innovativeness, the attitude of teachers toward using the internet, and internet use

... before adopting Late Majority The conservative or skeptical latter half of the mainstream They accept innovation late in the game, once the change has already become well-established among the majority ... to adopter categories, critical mass takes place at the point where the early majority begins the adoption process Moore’s (1991) observation of critical mass reveals that as an innovation passes ... Internet Attitude Analysis of Variance 197 K-l Age and Internet Attitude Analysis of Variance 197 K-12 Subject and Internet Attitude Analysis of Variance 197 K-13 Grade Level and Internet Attitude...

Ngày tải lên: 18/04/2017, 23:35

220 486 0
Using the ASP.NET AJAX Control Toolkit (Part 1)

Using the ASP.NET AJAX Control Toolkit (Part 1)

... PM Page 132 CHAPTER ■ USING THE ASP.NET AJAX CONTROL TOOLKIT (PART 1) libraries for its infrastructure Also, at the time of this writing, unlike the ASP.NET AJAX installable Msi package, the toolkit ... on a new AJAX-enabled aspx page As always, remember to have already added the ScriptManager control to the page when working with any of the control extenders in the AJAX Control Toolkit if the ... StartValue and EndValue properties that the tag uses for animation The ValuesScript property usually contains a comma-separated list of values that resemble a JavaScript array The animation...

Ngày tải lên: 05/10/2013, 10:20

34 504 1
Using the ASP.NET AJAX Control Toolkit (Part 2)

Using the ASP.NET AJAX Control Toolkit (Part 2)

... contains an image as shown here:

Ngày tải lên: 05/10/2013, 10:20

40 528 1
w