rotation around a center point

Alexander skutin, on rotation of a isogonal point

Alexander skutin, on rotation of a isogonal point

... is a circle Author is grateful to Alexey Pakharev for help in preparation of this text References [1] A V Akopyan Rotation of isogonal point Journal of classical geometry:74, 1, 2012 Moscow State ... that locus of points P is a circle It is clear that the transformation which maps H to P is a composition of an inversion, a parallel transform and rotations Indeed, denote by zx the coordinate ... REFERENCES 67 points A , A, P , and Q are cocyclic Similarly the quadrilateral P B ∗ BQ is inscribed in a circle Let lines AA∗ and BB ∗ intersect in a point F Indeed ABQH ∼ A B ∗ P H, so ∠(BQ, QA) =...

Ngày tải lên: 18/07/2014, 22:48

2 368 0
Sockets and Services from a Security Point of View

Sockets and Services from a Security Point of View

... mail service, on the other hand, is a large, complex piece of software that accepts data (mail) from and returns data to the client, as well as reads and stores data and configuration information ... Registration system Human−readable Internet addresses, like IP addresses, contain dots But Internet addresses can have as few as one dot or many more than four (although it is a rare address that ... paying attention to details like available hard disk space, network bandwidth, and so on Install a server−based virus scanner to sanitize e−mail attachments as well Security characteristics of the...

Ngày tải lên: 29/09/2013, 13:20

21 590 0
Unit 6 - Around a house C1, C2

Unit 6 - Around a house C1, C2

... What can you see in the pictures ? Tuesday , November 9th 2010 UNIT I Listen and read Then ask and answer the questions New words :  Look at (v) : nhìn vào A is tall  Tall (adj) :  Mountain ... between… and … : … và… A B C What is this ? It’s a well What are these ? They are mountains Where is the well? To the right of To the left of In Front of Where are the tall trees ? They arebehind ... _ Answer the questions a) Where is the yard ? - It is in front of the house b) Where are the tall trees ? -They are behind the house c) Where are the mountains ? - They are behind the tall...

Ngày tải lên: 13/10/2013, 18:11

23 894 4
Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

... was trained over a manually annotated corpus of approximately 208,000 words, and evaluated against an unseen portion with approximately 52,000 words It scored 86.53% precision and 84.94% recall ... inflection feature values, are displayed Now, any of these lemmas can also be clicked on, which will activate back the LX-Conjugator and will make the corresponding conjugation table to be displayed ... service takes a Portuguese nominal form — a form of a noun or an adjective, including adjectival forms of past participles –, together with a bundle of inflectional feature values — values of...

Ngày tải lên: 17/03/2014, 02:20

4 305 0
Báo cáo Y học: The human b-globin locus control region A center of attraction potx

Báo cáo Y học: The human b-globin locus control region A center of attraction potx

... of chromatin assembly Mol Cell Biol 21, 2629–2640 86 Ogawa, K., Sun, J., Taketani, S., Nakajima, O., Nishitani, C., Sassa, S., Hayashi, N., Yamamoto, M., Shibahara, S., Fujita, H & Igarashi, K ... USA 93, 13943–13948 50 Igarashi, K., Hoshino, H., Muto, A. , Suwabe, N., Nishikawa, S., Nakauchi, H & Yamamoto, M (1998) Multivalent DNA binding complex generated by small Maf and Bach1 as a possible ... HLH family of proteins and binds to DNA as a heterodimer usually composed of USF1 and USF2 USF has been implicated in the regulation of many genes and normally acts as a transcriptional activator...

Ngày tải lên: 18/03/2014, 01:20

11 461 0
FROM A LOGICAL POINT OF VIEW Logico-Philosophical Essays docx

FROM A LOGICAL POINT OF VIEW Logico-Philosophical Essays docx

... what does it mean to say that K, aa against M, N, etc., is the class of the “analytic” statements of Lo? By saying what statements are analytic for L, we explain ‘analytic-for-L0 but not ‘analytic’, ... keeps classical mathematics as a play of insignificant notations This play of notations can still be of utility whatever utility it has already shown itself tat have as a crutch for physicists and ... than analyticity itself III recent years Carnap has tended to explain analyticity by appeal to what he calls state-descriptions.’ A state-description is any exhaustive ass.ignment of truth values...

Ngày tải lên: 28/03/2014, 21:20

190 337 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... data quality and the thorough testing of validity against other standards The moderate response rate and that all data is self-reported, represent study limitations An external, unrelated variable ... seven all -point defined scales are used Seven categories are also harder to fit across a page of A4 with a reasonably sized typeface However, if the number of alternatives is less than the rater's...

Ngày tải lên: 18/06/2014, 22:20

9 491 0
Báo cáo sinh học: "Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach" pdf

Báo cáo sinh học: "Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach" pdf

... Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach Hassan Azadi Kenary1 , Choonkil Park∗2 , Hamid Rezaei1 and Sun Young Jang3 Department ... of Mathematics, University of Ulsan, Ulsan 680-749, Korea ∗ Corresponding author: baak@hanyang.ac.kr Email addresses: HAK: azadi@mail.yu.ac.ir HR: rezaei@mail.yu.ac.ir SYJ: jsym@ulsan.ac.kr Abstract ... | · | is called a non-Archimedean valuation, and the field is called a non-Archimedean field Clearly, |1| = | − 1| = and |n| ≤ for all n ∈ N A trivial example of a non-Archimedean valuation is the...

Ngày tải lên: 18/06/2014, 22:20

20 423 0
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc

Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc

... (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) Dog KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant ... USA) (9) Raccoon (Michigan, USA) A7 5/17 (10) A7 5/17 Dog (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) ... mortality in large felids [2], fresh-water seals (Phoca sibirica) [3], and various other animals CDV killed more than 10,000 Caspian seals (Phoca caspica) in year 2000 [4], and decimated an African...

Ngày tải lên: 18/06/2014, 22:20

14 347 0
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

... KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC ... GAACCGGGA ACGTCTAGAACAATACTGATC GGTCTC GTGCTCTAGAAGGTGATAGC CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA ... (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACMZV) and South African cassava...

Ngày tải lên: 18/06/2014, 22:20

23 613 0
Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx

Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx

... of Health and Human Services; 2001 Australian Institute of Health and Welfare and Commonwealth Department of Health and Family Services: First report on national health priority areas 1996 Canberra: ... the 4DSQ and a cutoff point can be used as a valid estimator for the prevalence of distress across demographic and occupational subgroups [29] A well-founded cutoff point can be used as a criterion ... management programs and guidelines that we miss clear criteria for the referral of employees with a certain level of distress to occupational health physicians or psychosocial care teams In addition,...

Ngày tải lên: 20/06/2014, 00:20

8 399 0
Báo cáo hóa học: " A fixed point theorem for Meir-Keeler contractions in ordered metric spaces" pot

Báo cáo hóa học: " A fixed point theorem for Meir-Keeler contractions in ordered metric spaces" pot

... Gnana Bhaskar, T, Lakshmikantham, V: Fixed point theorems in partially ordered metric spaces and applications Nonlinear Anal 65, 1379–1393 (2006) doi:10.1016/j.na.2005.10.017 Harjani, J, Sadarangani, ... which are fixed points of T and z ≠ y We consider two cases Case 1: Suppose that z and y are comparable Without loss of generality, we suppose z

Ngày tải lên: 20/06/2014, 22:20

8 405 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... doi:10.1186/1029-242X-2011-82 Cite this article as: Bae and Park: A fixed -point approach to the stability of a functional equation on quadratic forms Journal of Inequalities and Applications 2011 2011:82 Page of ... multidimensional functional equation having quadratic forms as solutions J Inequal Appl 2007 (2007) Article ID 24716 11 Rassias, TM: On the stability of linear mappings in Banach spaces Proc Amer Math Soc 72,...

Ngày tải lên: 20/06/2014, 22:20

7 429 0
Báo cáo hóa học: " Comment on “on the stability of quadratic double centralizers and quadratic multipliers: a fixed point approach” [Bodaghi et al., j. inequal. appl. 2011, article id 957541 (2011)]" pot

Báo cáo hóa học: " Comment on “on the stability of quadratic double centralizers and quadratic multipliers: a fixed point approach” [Bodaghi et al., j. inequal. appl. 2011, article id 957541 (2011)]" pot

... ∈ A , and a mapping R : AA is a quadratic right centralizer if R is a quadratic homogeneous mapping and R(ab) = a2 R(b) for all a, b ∈ A Also a quadratic double centralizer of an algebra A ... that a mapping L : AA is a quadratic left centralizer if L is a quadratic homogeneous mapping, that is quadratic and L(la) = l2 L (a) for all aA and l Î ℂ and L(ab) = L (a) b2 for all a, ... quadratic multipliers Assume that A is a complex Banach algebra Recall that a mapping T : AA is a quadratic multiplier if T is a quadratic homogeneous mapping, and a2 T(b) = T (a) b2 for all a, ...

Ngày tải lên: 20/06/2014, 22:20

7 367 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 184, 431–436 (1994) doi:10.1006/jmaa.1994.1211 Skof, F: Local properties and approximation...

Ngày tải lên: 20/06/2014, 22:20

14 481 0
w