rna dna or genes

Tài liệu Báo cáo Y học: Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation pdf

Tài liệu Báo cáo Y học: Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation pdf

... thermodynamics for the DNA/ DNA and RNA/ DNA oligonucleotide duplexes In the present study, we determined the temperatureindependent and temperature-dependent thermodynamic parameters of 24 DNA/ DNA and 41 RNA/ DNA ... the 41 RNA/ DNA hybrids These observations provide a thorough insight into the origin of the duplex association/ dissociation transition MATERIALS AND METHODS Material preparations DNA and RNA oligonucleotides ... should be noted that for short oligonucleotide sequences, the duplex formation behaves in a two-state transition [17,43], while for longer oligonucleotide sequences, the duplex formation often behaves...

Ngày tải lên: 22/02/2014, 07:20

10 449 0
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

... appropriate hSuv3p cDNA fragment using the following primers: CCGGAATTCTCGATGTCCTTCTCCC GTGC (forward; incorporating EcoRI site, underlined) and GCGGGATCCGAAACCGTGAGCTGAATCTGCC (reverse, incorporating BamHI ... GATTGAA (forward; incorporating EcoRI site, underlined) and CATGCCATGGCTAGTCCGAATCAGGTTC CT (reverse, incorporating NcoI site, underlined) The resulting fragment was cloned into pEG202 using EcoRI ... boiled for and resolved in the SDS ⁄ PAGE gel After electrophoresis the gel was dried and subjected to autoradiography Immunofluorescence experiments and cell fractionation For the immunofluorescence...

Ngày tải lên: 23/03/2014, 15:21

12 471 0
Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt

Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt

... The mechanism of RDO action for targeted gene correction is to repair mismatch after homologous alignment The DNA strand is responsible for the correction, while the RNA strand stabilizes the structure ... irrespective of the cationic vector or the cell type used Therefore, nuclear signal peptides are a putative strategy for nuclear location and penetration RDO is also reported to correct point mutations ... (1996) Correction of the mutation responsible for sickle cell anemia by an RNA- DNA oligonucleotide Science 273, 1386–1389 12 Wu, X.S., Liu, D.P & Liang, C.C (2001) Prospects of chimeric RNA- DNA oligonucleotides...

Ngày tải lên: 31/03/2014, 08:20

6 428 0
Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx

Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx

... Nested PCR and RT-PCR were performed on isolated RNA/ DNA samples from feces and urine to detect HIV-1 RNA/ DNA and CD4 mRNA Specific primers listed in Table were used for optimal detection of HIV-1 ... nested PCR reaction was performed to detect HIV-1 DNA from the isolated DNA using HIV-1 env specific primers HIV-1 DNA was detected from the DNA isolated from normal donor feces mixed with 8E5 cells ... occult blood test was negative for the fecal samples which were positive for HIV-1 RNA or DNA One of the five CD4 mRNA positive fecal specimens was positive for occult blood and the remaining...

Ngày tải lên: 10/08/2014, 05:21

11 338 0
Báo cáo y học: "Underexpression of mitochondrial-DNA encoded ATP synthesis-related genes and DNA repair genes in systemic lupus erythematosus" pot

Báo cáo y học: "Underexpression of mitochondrial-DNA encoded ATP synthesis-related genes and DNA repair genes in systemic lupus erythematosus" pot

... three crystallin genes, and genes encoding the receptor protein for melanocyte-stimulating hormone (melanocortin receptor) were grouped into both the sensory perception category and the response ... downregulated genes categorized into sensory perception included ATPase/ATPase domain-containing genes, two ERCC genes (ERCC2 and ERCC5), as well as six mtDNA-encoded genes Using network pathway ... Network pathway analysis of upregulated genes in the gene category regulation of apoptosis (a) Network and (b) Network constructed by 42 upregulated genes (c) Network graphical representation Genes...

Ngày tải lên: 12/08/2014, 15:23

9 238 0
Viruses viruses either enter or inject their DNA RNA

Viruses viruses either enter or inject their DNA RNA

... program; however, a worm is self­contained and does not need to be  part of another program to propagate itself.  History of Worms     The first worm to attract wide attention, the Morris  worm, was written by Robert Tappan Morris, who at  ... excess of $10,000.  Xerox PARC Worms…   Worms – is a small piece of software that uses  computer networks and security holes to replicate  itself. A copy of the worm scans the network for  another machine that has a specific security hole.  ... 27 January: SCO Group offers a US $250,000  reward for information leading to the arrest of the  worm's creator 1 February: An estimated one million computers  around the world infected with Mydoom begin the ...

Ngày tải lên: 15/03/2014, 13:08

23 617 0
Tài liệu Báo cáo khoa học: Transient DNA ⁄ RNA-protein interactions docx

Tài liệu Báo cáo khoa học: Transient DNA ⁄ RNA-protein interactions docx

... bound to the tRNAGln assume alternative conformations for the two consecutive reactions The catalytic centers of the two enzymes compete for the acceptor form of tRNAGln, and therefore cannot adopt ... the DNA nor the protein undergo large FEBS Journal 278 (2011) 1643–1650 ª 2011 The Authors Journal compilation ª 2011 FEBS Transient protein DNARNA interactions F J Blanco and G Montoya conformational ... of novel ones (for a brief review, see the Nobel Foundation Scientific Background published 50S proteins 50S rRNA tRNA, E-site tRNA, P-site tRNA, A-site mRNA 30S proteins 30S rRNA Fig Structure...

Ngày tải lên: 14/02/2014, 19:20

8 590 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... RGG3 are important for the binding of RGG3 to G-quadruplex DNA and RNA In ssDNA and ssRNA RGG3 (nM) Fraction of RNA bound Fig Binding affinity of RGG3 to Htelo or rHtelo The DNA or RNA concentration ... authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or ... 136, 175–186 Supporting information The following supplementary material is available: Fig S1 Affinity of RGG3 for binding to a G-quadruplex DNA and RNA Fig S2 CD spectra of DNAs and RNAs Fig S3 Binding...

Ngày tải lên: 15/02/2014, 01:20

11 788 0
Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc

... of DRc DNAzyme RNase A cleaved ssRNA and RNase H specifically FEBS Journal 277 (2010) 2543–2549 ª 2010 The Authors Journal compilation ª 2010 FEBS 2547 An RNA- cleaving and DNA- cleaving DNAzyme ... and ascorbate were important for the DNA- cleaving activity of DRc DNAzyme, they did not support the RNA- cleaving activity of DRc DNAzyme under our reaction conditions (100 lm Cu2+, 10 lm ascorbate, ... reconstructed DRc DNAzyme The DRc DNAzyme can form the DNA or RNA cleavage folded motifs under different reaction conditions FEBS Journal 277 (2010) 2543–2549 ª 2010 The Authors Journal compilation...

Ngày tải lên: 16/02/2014, 15:20

7 603 0
Tài liệu Báo cáo Y học: DNA and RNA damage by Cu(II)-amikacin complex docx

Tài liệu Báo cáo Y học: DNA and RNA damage by Cu(II)-amikacin complex docx

... dissolved in water and stored at )20 °C before use TRNAPhe cleavage analysis Prior to the reaction, the 32P labeled tRNAPhe was supplemented with carrier tRNAPhe to the final RNA concentration of ... prepared h before incubation with RNA; lane 21, tRNAPhe + 50 lM complex + 100 lM H2O2 prepared h before incubation with RNA; L, formamide ladder activates Cu(II) ions to cleave plasmid DNA on a redox ... of superhelical DNA to its linear form, and further, to a continuum of short DNA fragments (Fig 5C) The relative persistence of form (II) and the stepwise character of plasmid DNA degradation...

Ngày tải lên: 21/02/2014, 01:21

10 503 1
Chủ đề 0. Nhắc lại kiến thức cơ sở của DNA - RNA - Protein (Tải: https://link1s.com/yHqvN)

Chủ đề 0. Nhắc lại kiến thức cơ sở của DNA - RNA - Protein (Tải: https://link1s.com/yHqvN)

... (1) Chỉ có DNA cấu tạo theo nguyên tắc đa phân mà đơn phân nucleotit (2) Nucleotit DNA ARN có đường pento, axit photphoric bazo nito (3) DNA có đường C5H10O5 ARN có đường C5H10O4 (4) DNA thường ... Nucleotit DNA ARN có đường pento, axit photphoric bazo nito (3) DNA có đường C5H10O5 ARN có đường C5H10O4 Sai : DNA có đường C5H10O4 ARN C5H10O5 (4) DNA thường có nhiều đơn phân đến hàng triệu ... 0902651694 (5) DNA mạch kép ARN mạch đơn (6) DNA có tính đa dạng đặc thù (7) Nhờ có liên kết peptit mà phân tử DNA có tính bền vững linh hoạt Sai nhờ liên kết hidro liên kết yếu nên phân tử DNA vừa...

Ngày tải lên: 22/02/2014, 23:58

17 1,1K 0
Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt

Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt

... structure and dynamics of all possible DNA, RNA and DNARNA hybrid G-quadruplexes formed by short and long human telomeric sequences; (b) the structural basis for molecular recognition of human ... bisquinolinium ⁄ thiazole orange conjugates for fluorescent sensing of G-quadruplex DNA Angew Chem Int Ed Engl 48, 2188–2191 FEBS Journal 277 (2010) 1107–1117 ª 2009 The Author Journal compilation ª ... Basket-type form observed for d[A(GGGTTA)3GGG] in Na+ solution [31] (G) Propeller-type form observed for d[A(GGGTTA)3GGG] in a K+-containing crystal [27] (H) (3 + 1) Form observed for d[TA(GGGTTA)3GGG]...

Ngày tải lên: 06/03/2014, 09:22

11 480 0
Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

... both hyperphosphorylated IIO and hypophosphorylated IIA forms of RNA pol II H14 antibody is specific for early stage RNA pol II phosphorylated at Ser5, and 8WG16 antibody recognizes RNA pol II that ... Journal 273 (2006) 5535–5549 ª 2006 The Authors Journal compilation ª 2006 FEBS A K Rytkonen et al ¨ A B Fig UV crosslinking of replicative DNA polymerases to nascent DNA or RNA chains (A) DNA ... migrating form of RNA pol II (Fig 1) This suggested that Pol e associates with the RNA pol IIO isoform To characterize further the phosphorylation status of the RNA pol II FEBS Journal 273 (2006)...

Ngày tải lên: 07/03/2014, 11:20

15 585 0
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

... Fritsch, E.F & Maniatis, T (1989) Molecular cloning: a Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Dzierszinski, F., Popescu, O., Toursel, C., Slomianny, ... 5¢-CTTCACCTGGAGGAGATTTCC AAA-3¢ for 5¢ RACE and N34S 5¢-GGGAGGGTC TCGGCGTCAACAAAC-3¢ for 3¢ RACE Nested PCR was performed using internal oligonucleotides S10 5¢-GT CGAGATGTTGGTTGTCGGAGACC-3¢ for 5¢ RACE and PR2AS ... primers corresponding to the full-length ORF of T gondii TgDRE by using total RNA from tachyzoites, T, and in vivo encysted bradyzoites (B), RNA from uninfected human fibroblasts, H, or from naive...

Ngày tải lên: 08/03/2014, 22:20

9 422 0
Nucleic acids DNA & RNA

Nucleic acids DNA & RNA

... intertwine, forming a doublehelix that winds around a central axis How DNA Works 1- DNA stores genetic information in segments called genes 2- The DNA code is in Triplet Codons (short sequences ... (only in RNA) - Cytosine - Guanine DNA vs RNADNA 1- Deoxyribose sugar 2- Bases: Adenine, Thymine, Cytosine, Guanine 3- Double-stranded helix arrangement  RNA 1- Ribose sugar 2- Bases: Adenine, ... Deoxy = “minus oxygen” DNA Nucleotides Composition (3 parts): 1- Deoxyribose sugar (no O 2- Phosphate group 3- One of types of bases nitrogen): - Adenine - Thymine (Only in DNA) - Cytosine - Guanine...

Ngày tải lên: 13/03/2014, 16:34

11 674 0
Lecture 3 DNA RNA and protein synthesis great

Lecture 3 DNA RNA and protein synthesis great

... proteins  GENES code for proteins  GENES are long strands of DNA on chromosomes  What is DNA? DNA is the genetic code,  Instructions for heredity,  Components of genes,  Director of protein synthesis ... protein synthesis   AND- DNA is also A type of nucleic acid  A type of organic compound  A polymer {a compound made of repeating subunits}   WHAT DOES DNA STAND FOR? DNA s proper name isDeoxyribonucleic ... does an organism produce its particular protein?  As in, people protein vs tree protein?  The answer is DNA! The species-particular DNA sequences produce the species-particular proteins  GENES...

Ngày tải lên: 13/03/2014, 16:36

17 674 2
DNA, RNA and proteins

DNA, RNA and proteins

... GCA Alanine DNA and Protein Synthesis But… How does the information get from the DNA to the cytoplasm? mRNA DNA and Protein Synthesis - Transcription Transcription: 1) DNA unzips 2) mRNA (messenger ... ribosome in the cytoplasm DNA and Protein Synthesis - Translation Translation: 1) rRNA (ribosomal RNA) attaches to mRNA and starts reading the codons 2) tRNA (transfer RNA) – carries amino acids ... chain DNA and Protein Synthesis - Summary DNA and Protein Synthesis Practice making mRNA using the DNA template DNA and Protein Synthesis • Amino acids are linked together in the same order as...

Ngày tải lên: 13/03/2014, 16:38

18 1K 1
Embedded transfer RNA genes

Embedded transfer RNA genes

... for the canonical introns of the two embedded tRNA genes is the same tRNAGlu / tRNAeMet Embedded Genes of N equitans This is the second example Note in fig we illustrate these embedded tRNA genes ... tRNA genes overlap in archaea through introns, canonical and noncanonical Earlier, in mitochondrial tRNAs, overlaps of between one to six nucleotides have been reported tRNATyr and tRNACys genes ... Introduction: In our recent work1 we analysed cytoplasmic tRNA genes ( tDNA ) of 22 species of 12 orders of three phyla of archaea We looked for the identity elements for aminoacylation During this...

Ngày tải lên: 13/03/2014, 19:24

12 131 0
w