review and development of a predictive tool

... status in a New Zealand context, and allowed us to develop and validate a statistical model for available demographic factors, in our local patient population Methods Patient data This population-based ... Phyu Sin Aye1* , Sandar Tin Tin1, Mark James McKeage2,3, Prashannata Khwaounjoo2, Alana Cavadino1and J Mark Elwood1 Abstract Background: Targeted treatment with Epidermal Growth Factor Receptor ... nomogram for both Asian and non-Asian populations showed unsatisfactory accuracy in the study of Gevaert et al [26] It claimed that Asian patients had substantially different distributions of the...

Ngày tải lên: 06/08/2020, 05:46

... spiritual teacher and Guru, the late Pandurang Shastri Athavale (Dadaji), has played an almost invisible hand in making me the person I am today, and I was privileged to spend two years at an institution ... late 1980s and are starting to gain momentum in United States In Australia, they have become an important part of the healthcare delivery apparatus [11] A review of studies of HaH among medical ... system offers Hospital-at-Home in 11 care sites and Cedars Sinai medical center in Los Angeles offers HaH for its managed care and accountable care organization patients [42] A start-up called...

Ngày tải lên: 27/02/2022, 06:33

... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT TGGGGTGTTTGGGCAAC-3¢) ... was obtained from pJH2-SSTR2 by homologous sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... Trang 8activity By taking advantage of structural and func-tional similarities between yeast and mammalian GPCR signaling pathways, this assay enables the quantitative measurement of receptor activity,...

Ngày tải lên: 07/03/2014, 16:20

... metallo-endoprotease of Serratia marcescens(serralysin), are the alkaline protei-nase of Pseudomonas aeruginosa, the ZapA metallo-protease of Proteus mirabilis and proetases A, B, C, G and W of various ... internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized area of ... chain A (B) Change over time in the chromatographic peak area of cleavage fragments Note that the amount of frag-ments A1, A2 and A4 decreases on longer exposure to PrtA clea-vage (For details...

Ngày tải lên: 23/03/2014, 09:20

... mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A UDP datagram can be encapsulated ... need to maintain any state information for connection and flow control, as each datagram is handled independently from all other datagrams 2.1.2 User Datagram Protocol User Datagram Protocol ... TCP for data transport and demonstrate the integrated feature of network and storage functionalities as a means of delivering efficient and reliable service to applications We also Trang 32discuss...

Ngày tải lên: 16/09/2015, 15:54

... is laid out so as to increase the surface area of the heat sink The advantages of the heat pipe cooling are that thermal energy is moved away from the hot area, and spread over a larger area for ... Adsorbent-adsorbate pair Some of the commercially-available adsorbent-adsorbate pairs are silica water, zeolite-water, activated carbon-methanol and silica gel- methanol Among these pairs, the silica gel-water ... to a pair of adsorber and desorber is not new [25, 26] and it has been applied to humidification, dehumidification, gas purification and gas detection The amalgamation of the thermoelectric and...

Ngày tải lên: 04/10/2015, 10:25

... culture dish and lead screw are attached to an aluminium baseplate with a polycarbonate dust cover and can be installed in a suitable laboratory incubator Trang 35Figure 2.2 Schematic of the cell ... easily and reproducibly processable into a Trang 26variety of shapes and structures which retain their shape once implanted; display similar mechanical behaviour (shape of the stress–strain and ... and degradation [82,83,85] of a variety of contractile and regulatory proteins are measured Constant strain applied to fibroblasts seeded on collagen gels, induced fibroblast elongation and alignment...

Ngày tải lên: 04/10/2015, 10:25

... Class D Power Amplifier A Class D power amplifier uses a pair of transistors as a pair of switches that defines either a rectangular drain voltage or rectangular drain current waveform It also ... envelope signal with peak-to-average ratio A digital modulated signals is also not a simple sinusoidal signal, but consist of a carrier signal (which is a sinusoidal signal) modulated by a modulating ... substrate compared to the metal layers As a result, the inter-poly capacitor is best used as a shunt capacitor to ground where the parasitic capacitance can be lumped to the main capacitance Another...

Ngày tải lên: 04/10/2015, 10:25

... Prof Budiman Sastra (Adjunct Research Professor, Division of Engineering and Technology Management, National University of Singapore), for his professional guidance and invaluable advices all along ... and humanoid adopted by Gong and Nass [10] and Android from Mac-Dorman and Ishiguro [11] Mechanoid is a robot that is relatively machine-like in appearance and has no overtly human-like features ... by its appearance or movements, conveys a sense that it has intent or agency of its own [3] A robot can be a mechanical or virtual, artificial agent (e.g an avatar in a virtual world) According...

Ngày tải lên: 04/10/2015, 10:26

... retrofits [49] The results showed that the increase of ultimate capacity depends on many factors, and mechanical end anchorages “delay end and/or intermediate delamination” [49] The trilinear analytical ... and bond tests and full-scale shear strength tests A large increase in moment capacity gained by the relatively small amount of material of NSM FRP rods can improve a structure’s live load capacity, ... delayed delamination and enabled the NSM bar to experience at least a 77% higher strain at failure than the companion bar without anchors” [37] The methods of external bonding and near surface...

Ngày tải lên: 12/05/2017, 22:40

... (2021NDQN55); and also received support from the Xinchen Cup Cultivation Project of perioperative Anesthesia and ERAS in Chongqing (2018-MZ-2). Availability of data and materials The datasets used and analyzed ... complications The validation of the the nomogram prediction model was based on calibration and discrimination The calibra-tion curve demonstrated a good calibracalibra-tion because the actual line ... PONV Baseline assessments and surgical character-istics of the study population are shown in Table 1 Table 1 Baseline Assessments and Surgical Characteristics of the Study Population Abbreviations:...

Ngày tải lên: 12/01/2022, 22:27

... begin bygiving an overview of the hardware constituents of the system A Hardware Each stationary node consists of a stargate board, an ADC board, a battery, afluorometer and an array of 6 thermistors, ... lake at the northeast end and passes through an adjacent marsh areabefore reaching the lake proper Temperatures at 15:00 and 18:00 indicated a uniformwarming of surface waters (approximate range ... with Matlab andJava, provides a graphical interface for the system, and can be used to initialize and stopthe process of data collection Finally there is a set of miscellaneous software tools...

Ngày tải lên: 18/10/2022, 05:58

... Proterozoic metamorphic complexes are intruded by granitic, ultrabasic, basic and alkaline massifs (Fig 1) The Kola alkaline province includes 22 named alkaline and alkaline-ultrabasic massifs and about ... Pakhomovsky YaA (2002) Kovdor Laplandia Minerals Apatity Ivanyuk GYu, Goryainov PM, Pakhomovsky YaA, Konoplyova NG, Yakovenchuk VN, Bazai AV, Kalashnikov AO (2009) Self-organization of ore-bearing ... Features of Rare Mineral Localization Within Alkaline Massifs Gregory Yu Ivanyuk, Victor N Yakovenchuk, and Yakov A Pakhomovsky Introduction Alkaline and alkaline-ultrabasic massifs of the Kola Peninsula...

Ngày tải lên: 26/05/2016, 23:07

... panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’)2 fragments Panitumumab (Amgen) was ... M, et al: Cetuximab: Preclinical Evaluation of a Monoclonal Antibody Targeting EGFR for Radioimmunodiagnostic and Radioimmunotherapeutic Applications Cancer Biotherapy and Radiopharmaceuticals ... Organs 86 Figure Quantitation of tumor and normal organ distribution of Y-CHX -A -panitumumab F(ab’)2 (a) Receptor-mediated uptake of 86YCHX -A" -panitumumab F(ab’)2 of LS-174T tumor xenografts and...

Ngày tải lên: 21/06/2014, 02:20

... fetal bovine serum and antibiotics, and maintained in a humidified atmosphere of 5% CO2 at 37 °C [15] RNA preparation and quantification of RNA level Total RNA was extracted with Sepasol-RNAI (Nacalai ... MEK, also known as MAPK kinase [34], is an activator of ERK, a MAPK The MEK ⁄ ERK pathway is a critical signaling pathway that regulates a number of cellular functions such as cell growth and ... Luminoimage Analyzer (Fujifilm, Tokyo, Japan), and analyzed with multi gauge software (Fujifilm) Measurement of PGF 2a and PGE2 by enzyme immunoassay (EIA) Statistical analysis Cells were incubated...

Ngày tải lên: 28/03/2014, 22:20

... Al.tgϕδψ = A3 = ( X A cos ϕ − P sin ϕ )δs A = X A = Ptgϕ , M = Pltg 2ϕ ϕ ψ C  XA KM K  P A  Q Các ví dụ A ψ • Các di chuyển A δϕ O ϕ ϕ δψ O O  Q KM K  P δ = ( δϕ ≠ 0, δψ = 0, δsC = ) A ... 0, δsC = )  XA KM K C ψ  XA C  Q C ϕ ψ  XA  Q M KK  P δ = ( δϕ = 0, δψ = 0, δsC ≠ ) CHƯƠNG IV PHƯƠNG PHÁP LAGRANGE §4 Phương trình Lagrange loại hai 1.Rút phương trình Lagrange loại II 2.Biểu ... suy rộng 3.Phương trình Lagrange loại hai trường hợp lực 4.Các ví dụ 5.Các tích phân chuyển động §4 Phương trình Lagrange loại hai Rút hệ phương trình Lagrange loại hai Cơ hệ hô lô nôm, giữ,...

Ngày tải lên: 06/07/2014, 07:20

... defined as an amalgam of behavior and state, how objects are created, and how access to classes and to class members is controlled Namespaces are also described as an important aspect of “programming ... procedural approach is the separation of data and behavior Because data may be shared among several subprograms using global variables or parameters, responsibility for its behavior is scattered and ... firstName and lastName are assigned values that are read from the console (keyboard) and then passed as parameters to the methods SetFirstName and SetLastName of the object id Finally, the last and...

Ngày tải lên: 20/08/2012, 11:57

... main areas of English grammar at advanced level and concentrates on areas you need to pass the exams It looks, for example, at verb and noun structures, adverb and adjective structures, and ways ... (satellite television, film, radio ) and speak the language, so that you can use it naturally and easily Everybody can learn a language (we have al1 already learned at least one!), but it takes ... 14 15 A jailed A arrested A bombed A opens A demanding A echo A laugh A thrown A blurred A flick A decided A write A ridden A leaned A swamped B prisoned B called B attacked B starts B calling...

Ngày tải lên: 05/10/2012, 09:51

...   Hanoi 22 September 2010  Bill of Exchange  At……after sight of this first of bill of exchange  (second of the Same tenor and date unpaid ) pay to  Bank for Foreign trade of viet nam Or ... unpaid ) pay to  Bank for Foreign trade of Viet nam Or order the sum of one hundred thousand us dollars  Value received and charge the same to account of Famousbid Co Ltd Hongkong  a Drawn under ... Spot/forward - Transfer exchange rate PHÂN LOẠI TỶ GIÁ Căn vào chế quản lý ngoại hối a Fixed rate/floating rate b Official rate/market rate c Prime rate/commercial bank’s rate d Common rate/preference...

Ngày tải lên: 05/12/2012, 00:03