recognition of a crisis and its urgency

Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

... 0021-9045(88)90006-8 Shah, WM: A generalization of a theorem of Paul Turan J Ramanujan Math Soc 1, 67–72 (1996) Aziz, A, Rather, NA: A refinement of a theorem of Paul Turan concerning polynomials Math Ineq Appl ... Cite this article as: Zireh: On the maximum modulus of a polynomial and its polar derivative Journal of Inequalities and Applications 2011 2011:111 Submit your manuscript to a journal and benefit ... http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial of degree n, having all zeros in the...

Ngày tải lên: 20/06/2014, 22:20

9 423 0
A comparison on cohesive devices between the gift of the magi and its two vietnamese translation versions

A comparison on cohesive devices between the gift of the magi and its two vietnamese translation versions

... considering a single word, such as number, gender and tense Grammatical equivalence: related to the diversity of grammatical categories across languages Grammatical rules may vary across languages and ... Porter, was a physician When William was three, his mother died, and he was raised by his parental grandmother and paternal aunt William was an avid reader, but the age of fifteen he left school and ... the textual equivalence between the original work and its Vietnamese translations - To suggest some implications for teaching and learning translation in general and teaching and learning cohesion...

Ngày tải lên: 14/12/2013, 00:40

61 1K 3
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... human annotation In Proceeding of AMTA T Takezawa, E Sumita, F Sugaya, H Yamamoto, and S Yamamoto 2002 Toward a broad-coverage bilingual corpus for speech translation of travel conversations ... on Empirical Methods in Natural Language Processing and 947 Computational Natural Language Learning (EMNLP-CoNLL’2007), pp 277 – 286, Prague, Czech Republic, June S Jayaraman and A Lavie 2005 ... MT evaluation test set as our development set, and the NIST 2005 test set as our test set Table summarizes the statistics of the training, dev and test data for IWSLT and NIST tasks task data Sent...

Ngày tải lên: 17/03/2014, 01:20

8 548 1
a brief history of led zeppeln and its musical impact

a brief history of led zeppeln and its musical impact

... sound dated The music seems similar to music today The lasting impression of their music is obvious, and can be heard in any Rock band of today.Unfortunately, the machine that was Led Zeppelin came ... their official debut, Led Zeppelin were at the top of the bill at the Playhouse Theater in London, and the Pop Proms at the Royal Albert Hall in London On October 17, '69, a year and two days from ... Bonham had turned the wrong way in his sleep, and asphyxiated himself upon his own vomit A statement was released on December 4, 1980, stating that the band could not go on in its present state After...

Ngày tải lên: 21/03/2014, 21:54

3 325 0
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

... X and Y (and X and Y are correlated), then X will be correlated with A and will have an effect on Y independent of X A moderator variable is one that affects (usually reduces) the causal relationship ... performance by helping reduce uncertainty associated with stress and improving the accuracy of individual expectations and performance of certain tasks (Glass and Singer, 1973) Moderators can also act ... military personnel For example, Mareth and Brooker (1985) find that battle fatigue and other stress reactions may account for as many as 50 percent of the casualties in a given war As a result of...

Ngày tải lên: 29/03/2014, 18:20

86 611 0
LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

... important as maintaining the rule of law; and just as every fundamental aspect of the defence of the realm must be real and practical, so must every fundamental aspect of the rule of law – sound laws, ... to say that it does not last as long, but with the increase in the length of the average trial and the decrease in the length of the average marriage, we may be approaching a cross-over And a trial, ... be a step too far It clearly has its advantages in so far as reducing cost and time is concerned And technology may well, in a short time, advance to an extent that a witness could be cross-examined...

Ngày tải lên: 31/03/2014, 03:20

16 471 0
báo cáo hóa học:" The impact of iron overload and its treatment on quality of life: results from a literature review" pptx

báo cáo hóa học:" The impact of iron overload and its treatment on quality of life: results from a literature review" pptx

... Psychosocial and clinical burden of thalassaemia intermedia and its implications for prenatal diagnosis Arch Dis Child 1995, 72:408-412 Caro JJ, Ward A, Green TC, Huybrechts K, Arana A, Wait S, ... Cohen A, Piga A, Bejaoui M, Perrotta S, Agaoglu L, Aydinok Y, Kattamis A, Kilinc Y, Porter J, Capra M, Galanello R, Fattoum S, Drelichman G, Magnano C, Verissimo M, Athanassiou-Metaxa M, Giardina ... were searched including Cochrane Database of Systematic Reviews (CDSR), American College of Physicians Journal Club (ACP), Database of Abstracts of Reviews of Effects (Dare), and Cochrane Control...

Ngày tải lên: 20/06/2014, 16:20

6 735 0
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

... SD2R1F TAGAATTCATCGCCACGACCATG SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay PD3 simX5D3R simEXX4F TAGAATTCGCGACAGGAGCCATA TAGAATTCGACGCCTTCCAGTC DNA-shift assay PX4 ... CCAATTGCGCTACGCTCCT DNA-shift assay PSEx1 PEx1R simA7F CCATGTAGGCGGTGACGA TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay PA7 simA7R ATAAGCTTGTCGATACCGATCTTC DNA-shift assay PEx2 DNA-shift assay PSR3 PEx2F ACTTCCCAGAAGTA ... TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG DNA-shift assay PR2Ex SR2ExXR TTTGAATTCTTGACCACCACTTC DNA-shift assay PSR2 PSR2F TCGACGAGGTCCTCTTTG PSR2R TCGTATTCATACACCGTAC PEx1F CCAATTGCGCTACGCTCCT...

Ngày tải lên: 21/06/2014, 17:20

12 456 0
Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx

Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx

... Engineering, Academic Press, New York, NY, USA, 1979 19 S.-H Wu, “Generalization and sharpness of the power means inequality and their applications,” Journal of Mathematical Analysis and Applications, ... mean values,” Journal of Convex Analysis, vol 15, no 4, pp 707–718, 2008 17 G D Anderson, M K Vamanamurthy, and M Vuorinen, “Generalized convexity and inequalities,” Journal of Mathematical Analysis ... Analysis and Applications, vol 335, no 2, pp 1294–1308, 2007 18 A W Marshall and I Olkin, Inequalities: Theory of Majorization and Its Applications, vol 143 of Mathematics in Science and Engineering,...

Ngày tải lên: 22/06/2014, 02:20

15 302 0
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt

Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt

... S Agaian, J Astola, and K Egiazarian, Binary Polynomial Transforms and Non-linear Digital Filters, Marcel Dekker, New York, NY, USA, 1995 [4] S S Agaian and A K Matevosian, “Generalized Haar ... Hadamard-like and Haar-like transforms, which are of a particular interest since they are generalizations of the classical Hadamard and Haar transforms Definition Within the class Ω consider the family Ω of ... with a fast algorithm of the same structure In particular, a family of Haar-like transforms that can all be computed with fast algorithm in structure similar to classical fast Haar transform algorithm...

Ngày tải lên: 22/06/2014, 20:20

14 485 0
Báo cáo vật lý: "A Perspective of Oil Palm and Its Wastes" doc

Báo cáo vật lý: "A Perspective of Oil Palm and Its Wastes" doc

... Kedah Kelantan Melaka Negeri Sembilan Pahang Perak Perlis Pulau Pinang Selangor Terengganu Peninsular Malaysia Sabah Sarawak Sabah and Sarawak Malaysia Quantity difference (ha) 3,553 857 4,656 ... A. , Ani, F N & Kannan, K S (1999) Renewable energy scenario in Malaysia In M A Razzaq Akanda & M A Rashid Sarkar (Eds.) 2nd International Seminar on Renewable Energy for Poverty Alleviation at ... A Perspective of Oil Palm and Its Waste 68 Malaysia's National Energy Policy aims to have an efficient, secure and environmentally sustainable supply of energy, as well as efficient and clean...

Ngày tải lên: 07/08/2014, 14:20

11 672 0
Báo cáo khoa học: "A critical review of larch hybridization and its incidence on breeding strategies" potx

Báo cáo khoa học: "A critical review of larch hybridization and its incidence on breeding strategies" potx

... vegetative propagation, and the ease of its establishment in plantations Growth traits, stem and crown habits (basal sweep, stem straightness, branching habits), wood quality, and pest resistance ... more lowland areas has not been successful in France Several provenance tests have shown its poor adaptation, slow growth, and canker susceptibility (Lacaze and Birot, 1974; Ferrand and Bastien, ... rates comparable to other vigorous species such as Douglas fir and an apparent wide soil adaptability on Rational use of the parental populations and their evaluation through hybridization as...

Ngày tải lên: 09/08/2014, 02:21

13 423 0
báo cáo khoa học: "Emotional stress as a trigger of myasthenic crisis and concomitant takotsubo cardiomyopathy: a case report" pot

báo cáo khoa học: "Emotional stress as a trigger of myasthenic crisis and concomitant takotsubo cardiomyopathy: a case report" pot

... was calculated as 32% on a cardiac catheterization and 40% on a transthoracic echocardiogram Shortly after cardiac catheterization, she developed bilateral ophthalmoparesis, significant bulbar ... the manuscript JTW analyzed and interpreted the patient’s data and was a major contributor in writing the manuscript AF is a cardiologist who analyzed and interpreted the patient’s data regarding ... microcirculation of the heart, and elevated catecholamine states [4,7] TC has been described in many different stressful and catastrophic circumstances such as car accidents, family deaths, and even major...

Ngày tải lên: 11/08/2014, 02:22

4 239 0
báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx

báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx

... The data set was made up of data from eight repetitions of each ripening stage of RH and RHB The variable set was made of the major 41 volatile aroma compounds PCA involves a mathematical procedure ... developmental and genetic cues, and pointed out the central role of carotenoid cleavage dioxygenases, namely the product of ccd4, in flesh color and peach aroma formation By taking advantage of a wild ... stages and plastid transition from chloroplasts into chromoplasts At early ripening stages S1 and S2, fruits of RHB and RH had similar total carotenoid levels and accumulated only a few carotenoid...

Ngày tải lên: 11/08/2014, 11:21

14 303 0
báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc

báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc

... 22.9 AC122169 AC148995 26.4 AC175829 29.9 Figure An example of synteny between A- and B- genomes of Arachis and Medicago An example of synteny between A- and B- genomes of Arachis and Medicago Alignment ... and six of A magna (K30097) were used as female parents (see Additional file 1) A total of 993 flowers were cross-pollinated, of which 515 and 478 had A ipaënsis and A magna as female parents, ... B3 Ap32# Ar10 Figure A linkage map for the B-genome of Arachis A linkage map for the B-genome of Arachis Linkage map of Arachis based on an F2 population resultant from the cross A ipaënsis × A...

Ngày tải lên: 12/08/2014, 03:20

10 399 0
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx

Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx

... (principally the laboratory mouse), or are of commercial significance (such as farmed animals such as chickens, horses, goats, cattle and fish, and pets), where they cause a number of commercially ... the causative agent of several slow progressive diseases in animals including arthritis and encephalitis in goats, leukemia in cattle, anaemia in horses, and immunodeficiency in cats, cattle, ... and BLV and related viruses form a separate class of complex retroviruses that cause leukemia in a small percentage of infected individuals after very long latency periods Retroviruses have also...

Ngày tải lên: 14/08/2014, 19:22

13 506 0
Development of a realistic finite element model of human head and its applications to head injuries

Development of a realistic finite element model of human head and its applications to head injuries

... facial bones and cranial bones as well as intracranial injuries are evaluated based on the tolerance limits of the biomechanical parameters General trend of maximum intracranial biomechanical parameters ... to all of my colleagues and my best friends Arpan Gupta, Guo Shifeng, Zhu Jianhua, Zhuang Han, Liu Yilin, Kyrin Liong, Saeid Arabnejad Khanooki, Shahrokh Sepehri Rahnama, Ahmadali Tahmasebimoradi, ... unpaired vo omer and mandi ible as well as paire lacrimal, nasal, pa ed alatine, infe erior turbin nate, maxillary a zygoma bones The primar function of the cran bones is to and atic ry nial...

Ngày tải lên: 10/09/2015, 09:04

347 368 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

... surface plasmons (a) p-polarisation; (b) spolarization 115 R E2 (b) (a) R E2 (c) 2 (d) Figure A map of R and E versus d (thickness of the metal film 1) and θ o (a and b) spolarization (c and ... slab Slab thicknesses are indicated in the graph Data are calculated based on the EM theory of a 3-layers stratified system Dielectric constants of Au are evaluated using the experimental data ... nm array of 100-nm spherical nanocavities (c) µm × µm array of 200-nm spherical nano-cavities (d) 1.5 µm × 1.8 µm array of spherical 300-nm spherical nano-cavities, and (e) 1.8 µm × 2.2 µm array...

Ngày tải lên: 14/09/2015, 14:01

163 452 0
Studies of vortex breakdown and its stability in a confined cylindrical container 1

Studies of vortex breakdown and its stability in a confined cylindrical container 1

... cross-correlation and Dr Lua Kim Boon for his assistance in the Labview programming I am also grateful to the Technical Staffs of the Fluid Mechanics Laboratory for their valuable technical assistance and ... state at Re = 2760 and Λ = 1.704, and (b) an LC2 state at Re = 2750 and Λ = 1.780, (each state is asymptotically stable) 81 xii Fig 5.12 Variation of ΔE0 with Re for (a) LC1 and (b) LC2, at various ... bubbles along the axis are related to asymmetries that originate inside the stationary-cover Ekman layer and the sidewall Stewartson boundary layer, and that in the unsteady regime the spiral separation...

Ngày tải lên: 14/09/2015, 14:02

43 215 0
Studies of vortex breakdown and its stability in a confined cylindrical container 2

Studies of vortex breakdown and its stability in a confined cylindrical container 2

... viscosity and temperature obtained using a Haake Rheometer Since the data was sampled and acquired over about 20 minutes, Re is nominally constant For those cases with fixed Reynolds number and varying ... cross-correlation analysis, with one of the frames selected as a reference (mask) Obviously, a high crosscorrelation value (maximum value of 1), indicates that the reference frame and the pattern under analysis ... images were captured using Sony 3CCD color video camera (25 fames per second), which enables the analysis of the flow dynamics, as well as allowing still image to be captured via a frame grabber...

Ngày tải lên: 14/09/2015, 14:02

11 210 0
w