ramark signal appearing as a dashed line

... A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S-1 plus cisplatin versus S-1 alone for first -line ... with advanced gastric cancer Cancer Chemother Pharmacol 2009, 64:877-883 Yoshida K, Hirabayashi N, Takiyama W, Ninomiya M, Takakura N, Sakamoto J, Nishiyama M, Toge T: Phase I study of combination ... therapy with S-1 and docetaxel (TXT) for advanced or recurrent gastric cancer Anticancer Res 2004, 24:1843-1851 Yoshida K, Ninomiya M, Takakura N, Hirabayashi N, Takiyama W, Sato Y, Todo S, Terashima...

Ngày tải lên: 09/08/2014, 03:21

... the participants that underwent the global screening by means of the BARO as well as the elaborate forensic diagnostic assessment The concurrent validity was based on the correlation of the BARO ... youth and parents separately, nor to interview third party informants The additional travelling time in particular might have increased the total duration of the assessment Further adaptations that ... account First, as it is not known how long a traditional CPB assessment took in the past, it was not possible to compare the duration of BARO administration In the past, it was neither practice to...

Ngày tải lên: 13/08/2014, 18:22

... ·) Rabbit antibody to PrxII and an Alexa-647-labeled goat antirabbit IgG secondary were used to visualize PrxII Mouse monoclonal antibody to HA and an Alexa 488-labeled goat anti-mouse secondary ... Valencia, CA, USA), and rocked at °C for h The lysate ⁄ Ni ⁄ nitrilotriacetate bead mixture was transferred to a poly prep chromatography column and the agarose packed The column was washed twice ... precedes PLD1 translocation to the plasma membrane (Fig 6) Other stimulation-dependent interactions that occur after PLD1 translocates to the plasma membrane may occur and await discovery What might...

Ngày tải lên: 20/02/2014, 01:20

... kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal- regulated kinase (ERK), a ... Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test (a ¼ 0.05) with the Bonferroni adjustment was used to compare ... costimulation of phospholipases such as PLC and PLA2 by heat shock and the resultant release of lipid mediators could also enhance the subsequent membrane association and activation of protein kinase...

Ngày tải lên: 07/03/2014, 12:20

... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...

Ngày tải lên: 22/03/2014, 16:20

... but also to the activation of p42/44 MAPK (also called ERK1/2) through the Ras/Raf/ MAPK kinase/MAPK cascade (where Raf is a MAPK kinase kinase and MEK is a MAPK kinase) [29,30] However, the activation ... decades, has clearly shown that in addition to its established role as an ion pump, Na+/K+-ATPase also functions as a signal transducer to relay messages from the plasma membrane to the intracellular ... the past few years [22–26] have clearly indicated that the same nontoxic concentrations of ouabain that cause partial inhibition of Na+/K+-ATPase and an increase in cardiac contractility, also...

Ngày tải lên: 24/03/2014, 00:21

... perivascular lymphocytic infiltrates characterize the inflammatory phase The skin appears indurated at this time The collagen bundles become hyalinized, thus replacing subcutaneous fat and muscle, ... clinical forms: generalised, morphoea (atrophic and sclerotic Histopathogenesis shows two phases: an inflammatory phase and sclerotic phase [6] Coarsened collagen bundles in the reticular dermis ... colored, band-like depression (en coup de sabre) of the frontoparietal region is characteristic Scleroderma may occur as a systemic disease or as a localised form [3] Localised scleroderma presents...

Ngày tải lên: 11/08/2014, 10:23

... intercept and an environment deviating SD when the variance in the slope was small (a small variance ratio, little G × E), but a larger influence with a larger variance in the slope (larger variance ratio, ... individuals of the same litter The slope of a linear reaction norm is a measure of sensitivity towards environmental change, which can be treated as a trait of the animal [8] Genetic variation ... breeding and environmental values are expressed as deviations from the average reaction norm As is common in animal breeding, covariances between residuals of different individuals and covariances...

Ngày tải lên: 14/08/2014, 13:22

... underinvestment and increasing load demand As a result, the grid has to operate at a higher load demand with an aging infrastructure [5] Increased sensing is required to enable the operators to maximize ... require at least a fundamental cycle length of data As this technique can extract the required parameters using a much shorter sampling window width, it can potentially allow faster evaluation and ... of signal processing in these areas The application, advantages and disadvantages of relevant signal processing techniques are also discussed in this chapter • Chapter describes the mathematical...

Ngày tải lên: 01/10/2015, 17:27

... inhibition of ataxia telangiectasia mutated (ATM) and ATM and Rad3-related (ATR) protein kinases though detail mechanism has yet being elucidated (d'Adda di Fagagna et al 2003; Takai et al 2003) Telomeres ... have an exposed 53BP1 interaction site thereby activates the DNA damage surveillance pathway TRF2 was proposed as an ATM inhibitor as it was found to be able to physical interacts with ATM at ... Telomerase related screen Wnt signaling pathway Canonical Wnt pathway Non-canonical Wnt pathway Material and Methods Material Cell line Inhibitor library Plasmid List of primers List of antibodies...

Ngày tải lên: 02/10/2015, 17:14

... that glial cells also play a part in exaggerated pain states created by inflammation and neuropathy (Hashizume et al., 2000; Watkins and Maier, 2002) Astrocytes, in particular, play an important ... Amino acids including aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain patients as compared to that of acute pain patients ... cells are activated and release pro-inflammatory cytokines and other pain enhancing substances This affects the presynaptic release of neurotransmitters, postsynaptic excitability, as well as a self-propagating...

Ngày tải lên: 02/10/2015, 17:15

... packages có tên samba rpm –qa samba* => liệt kê packages có tên bắt đầu samba rpm –qa | grep samba => liệt kê packages có tên ch a samba rpm –qd samba => liệt kê files tài liệu liên quan đến samba ... a Cao, Q.1, TP.HCM Tel: (84-8) 38244041 – 0989012418 www.athena.edu.vn - Bạn liệt kê danh sách packages cài đặt (Installed packages) danh sách packages dùng cho bạn download (Available packages) ... (configuration) liệt kê tập tin cấu hình package 3/ Gở bỏ package (Erase): Chú ý: Nếu gỡ bỏ package mà package phụ thuộc vào package khác gỡ bỏ ta dùng thêm tuỳ chọn nodeps  Lỗi package samba-3.0.23c-2.rpm...

Ngày tải lên: 13/09/2012, 10:21

Ngày tải lên: 04/10/2012, 10:24

... Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure PROC GENMOD (SAS ... than days of absence per annum decreased from 2.77 to 2.68, and remained significant There was an increased risk of disability pension for people who were smokers at baseline, whereas there was ... baseline DWECS questionnaire and disability pension data derived from DREAM among the 4177 persons categorized as 18-45 year old employees at baseline Outcome A disability pension case was defined...

Ngày tải lên: 26/10/2012, 10:03

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7] ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature...

Ngày tải lên: 02/11/2012, 11:12

... straight away without stopping at a petrol station After having talked and talked and talked, and when I finally managed to dismiss her with fake half-promises and sat back into my car at last ... I knew it wasn’t so A more ominous explanation came to my mind Maybe everything was real, and it was taken for granted that I was dead, just I wasn’t! My brain was still working, and I would ... body Admiration and even something like awe Was he awed because she was dead, by the mystery of death? No, he was awed because in his eyes she was beautiful, a beautiful young woman… For a split...

Ngày tải lên: 07/11/2012, 09:08

... 2005), he also makes a distinction between task-based teaching and tasksupported teaching The task-based teaching occurs when the teaching is based exclusively on meaning-focus tasks, and the task-supported ... functions and language notions are taught to learners at the same time with the assumption that language learning relates to learning formulaic expressions of language as well as learning rules of language ... II.1 A review of language teaching approaches Teaching language has received much focus for the past few decades So many approaches and methods such as Audiolingual Method, Total Physical Response,...

Ngày tải lên: 07/11/2012, 14:44

... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample...

Ngày tải lên: 03/04/2013, 21:06

... BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the...

Ngày tải lên: 23/04/2013, 21:38

... Piping and Conveyance, Surge/Balancing Tanks, Filters, Pump and delivery piping system A separate sanitary plumbing system has to be installed to separate the grey water from the wastewater discharges ... irrigation and also landscaping Mature Cotton plants Photo: Texas A& M University Young Tomato Plants Photo: Texas A & M University The Water Environment Research Foundation, USA carried out a study ... Grey Water Reuse As A Sustainable Alternative Water Resource The laundry greywater is more contaminated with faecal pathogens from soiled clothing than the bathroom source, though laundry water...

Ngày tải lên: 25/04/2013, 08:20