publishing a crl to an os 400 ldap server

... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... dr.Close( ); conn.Close( ); // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... Cursors.Default; return; } try { // Load the ADO recordset into a DataTable OleDbDataAdapter oleDa = new OleDbDataAdapter( ); DataTable dt = new DataTable("Orders"); oleDa.Fill(dt, rs); // Bind the default...

Ngày tải lên: 14/12/2013, 18:16

... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...

Ngày tải lên: 26/01/2014, 10:20

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... basic motifs is unusually longer (30 amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited...

Ngày tải lên: 18/03/2014, 01:20

... prevention are readily understandable, and certainly greatly appreciated But maximum possible lifespan is a mystery that continues to fascinate us T h e causes of human death have changed dramatically ... AND LIFESPAN Table 1.2 Maximum Possible Lifespans for Selected Species Common Name Marine bivalve (Giant) tortoise Human Maximum Lifespan (Years) 220 180 122 Elephant 70 Halibut 60 Orangutan ... age 30 Skin and hair Loss of subcutaneous fat; appearance of wrinkles, pigmentation Graying of hair at all body sites; loss on top of head; some facial hair may increase Nails thicken Heart and...

Ngày tải lên: 11/06/2014, 05:26

... radiant with joy On the walls, different patterns of modern paintings were hung: charcoal drawings, pencil drawings and oil paintings were on display Most of them reflect daily activities and ... brought me back into my happy and peaceful past, full of love and tenderness, among my dear ones Before leaving the exhibition halls, I bought the postcards of my favorite paintings to keep as souvenirs ... by Lu Tong Dao, one of the most famous artists in HCM city, portraying a scene at twilight in the country attracted my attention best: on a long and lonely road, a buffalo tender, sitting astride...

Ngày tải lên: 22/07/2014, 04:20

... cautious, calculating habits; and they have always more or less of a nasal twang.' A TO ZED, A TO ZEE PART THREE Grammar and Usage In grammar and syntax, American and British English are remarkably ... the a in US English US GB anaemia anemic anaemic anesthetic anaesthetic anesthetist anaesthetist cesarean caesarean diarrhea diarrhoea edema oedema enology, oenology oenology esophagus oesophagus ... it is long and firm: Returning from the daaanse claaase, she ran a baaath Near the end of the 18th century, southern England began to change from what is called a flat a to a broad a in these...

Ngày tải lên: 05/10/2012, 08:22

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7]...

Ngày tải lên: 02/11/2012, 11:12

Ngày tải lên: 06/11/2012, 10:35

... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...

Ngày tải lên: 06/11/2012, 10:35

... familiar with Agreeing and Disagreeing, Giving an Explanation or Making an Argument Some thought that Cause and Affect pattern of essay organization should be paid more attention to TWE preparation It ... Agreeing and disagreeing (AD); Stating a preference (PR); and Giving an explanation (EX) that learners can flexibly apply to their writing with each pattern of essay organization Sometimes, a combination ... organizations of cause and effect essay: block and chain In block organization, all the causes are discussed as in a block and the all the results are mentioned in another block In chain organization,...

Ngày tải lên: 06/11/2012, 10:35

... have to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can more easily to ... parents are important teachers when children are small but they cannot be the best ones all the time There’s still a gap between children and parents in every family WRITING PAPER Name: Group A Paper: ... children are small, their parents can take care of them closely But when they grow up, they go to school, have friends and teachers, so they can learn from their friend, their teacher and their...

Ngày tải lên: 06/11/2012, 10:35

... boss wants to talk with you The boss wants to talk to you My aunt came over to see us My aunt came round to see us He parked in back of the restaurant He parked behind the restaurant You'll have ... intensifier A TO ZED, A TO ZEE US GB That was a real nice meal That was a really nice meal He drives real fast In informal American English, real is often used before adjectives and adverbs where ... the opening match Italy is (or are) scheduled to play Brazil in the opening match Air France has announced additional flights Air France have (or has) announced additional flights Prepositions It's...

Ngày tải lên: 25/10/2013, 15:20

... the a in US English US GB anaemia anemic anaemic anesthetic anaesthetic anesthetist anaesthetist cesarean caesarean diarrhea diarrhoea edema oedema enology, oenology oenology esophagus oesophagus ... it is long and firm: Returning from the daaanse claaase, she ran a baaath Near the end of the 18th century, southern England began to change from what is called a flat a to a broad a in these ... as-fault as-felt ate ate et ballet bal-ay bal-ay bitumen bi-too-men bich-er-men buoy boo-ee boy Byzantine biz -an- teen bi-zan-tine Caribbean k'-rib-ean kari-bee -an charade sha-raid sha-rahd chassis...

Ngày tải lên: 25/10/2013, 15:20

... English Thai English English Vietnamese Vietnamese m t s qu c gia v vựng lónh th Qu c gia Cambodia Cambodia Indonesia Lao People's Dem Lao People's Dem Malaysia Malaysia Singapore Taiwan Thailand United ... Trey Damrey Bakutut Pa boo Pa bou Goby Belantuk Soon hock Marble goby Pla boo jak Marble goby Marbled sleeper Cỏ Bong Cỏ B ng t ng Ngụn ng Khmer Khmer Malay Laotian Laotian English Malay Cantonese ... 1758 - animals Subkingdom: Bilateria (Hatschek, 1888) Cavalier-Smith, 1983 - bilaterians Branch: Deuterostomia Grobben, 1908 - deuterostomes Infrakingdom: Chordonia (Haeckel, 1874) Cavalier-Smith,...

Ngày tải lên: 06/12/2013, 19:34

... analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, first beam results, and ... development at CEA/Saclay Rev Sci Instrum 75(5): 1414–1416 http://laacg1.lanl.gov Poisson code, Reference manual, LA-UR-87-126, LANL 1987 Jain S K, Jain A, Sharma D, Hannurkar P R 2006 Acquisition and analysis ... solutions and precision measurements Nucl Instr Meth Phys Res A2 98: 13–21 Bhawalkar D D, Bhujle A G, Fatnani P, Hannurkar P R, Joshi S C, Karmarkar M G, Kotaiah S, Mhaskar S P, Pande S A, Prabhu S...

Ngày tải lên: 22/12/2013, 08:58

... Standards and Quality Standards Department, Agency for Industrial Science and Technology, MITI ASEAN/Japan Cooperation Program for Standardization and Total Quality Management ASEAN/JAPANI/UNIDO TQM ... programme, known as the Japan/ASEAN Cooperation Programme for Standardization and Total Quality Management, aims to provide ASEAN countries with the tools and methodologies that will promote standardization ... Calzadilla-Sarmiento, then Project Manager, Quality, Standardization and Metrology Branch, UNIDO A Roadmap to Quality has been developed with valuable assistance and support provided by Japan's...

Ngày tải lên: 18/02/2014, 11:20

... Omura S, Ikeda H, Ishikawa J, Hanamoto A, Takahashi C, Shinose M, Takahashi Y, Horikawa H, Nakazawa H, Osonoe T, et al (2001) Genome sequence of an industrial microorganism Streptomyces avermitilis: ... it to display monophenolase and o-diphenolase activity or just the latter activity For instance, all catechol oxidases from tomato, potato and beans have the aromatic residue at the equivalent ... Garcı´ a- Borron JC, Valverde P, Solano F & Lozano JA (1993) Tyrosinase isoenzymes in mammalian melanocytes Biochemical characterization of two melanosomal tyrosinases from B16 mouse melanoma Eur...

Ngày tải lên: 19/02/2014, 07:20

Ngày tải lên: 05/03/2014, 16:20

... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz ... AAAI, pages 412–418 C Kruengkrai, K Uchimoto, J Kazama, Y Wang, K Torisawa, and H Isahara 2009 An error-driven word-character hybrid model for joint chinese word segmentation and pos tagging ... the ambiguity problem that a Chinese character may appear in any relative position in a word and the out-of-vocabulary (OOV) problem that it is impossible to observe all words in training data,...

Ngày tải lên: 07/03/2014, 18:20

... immunohistochemistry and ELISAs, and guided or performed image analysis, analyzed data and drafted the manuscript LJ performed tissue preparation, immunohistochemistry, image analysisand ELISAs KT carried ... Unger WW, Jansen W, Wolvers DA, van Halteren AG, Kraal G, Samsom JN: Nasal tolerance induces antigen-specific CD4+CD25regulatory T cells that can transfer their regulatory capacity to naive CD4+ ... colony and vaccination was begun at 4.0 ± 0.1 months of age Mice were genotyped using PCR All animal use was approved by the Harvard Standing Committee for Animal Use and in compliance with all state...

Ngày tải lên: 19/06/2014, 22:20