... receptive language and productive language Receptive language is the language factor possibly realized and not produced by learners Productive language is the language factor possibly used in speaking ... first flashcard, and continue in the same way Remove the second flashcard in the same way and repeat all the words again And then remove the next one and repeat all the words again In a simple activity ... brush.Wash your face, wash, wash, wash Wash your hands, wash, wash, wash Clap our hands, clap, clap, clap Shake our hands, shake, shake, shake In order to get the students’ attention, I say: If
Ngày tải lên: 10/12/2016, 13:52
... Pharmin-gen)beforestaining.Cellswerestainedwithanti-CD3-FITCplus anti-NK1.1-PerCPCy5.5,andanti-CD3-Allophycocyanin(APC)plus anti-DX5-PE.Stainedcellswereanalyzedbyflowcytometry,FACS Calibur.AllcytometricdatawasanalyzedusingFlowJosoftware Theassaywasrepeatedtwice ... 2h.Beforedetection,biotinylatedanti-mouseantibodywasadded andincubatedatRTfor1h.Streptavidin-horseradishperoxidase conjugatewasaddedandincubatedatRTfor30min.Recombinant mousecytokineswereusedasastandardandcytokinesquantified byinterpolationfromastandardcurve ... unprecedentedwhilethestrainthatmaycauseapandemic can-notbepredictedandcurrentparenteralseasonalinfluenzavaccines arealllargelystrain-specific[1].Inaddition,suchavaccineshould havethreefurtherattributes:besafe,requirealowantigen
Ngày tải lên: 16/12/2017, 01:20
Make tips and tales from the workshop a handy reference for makers
... spirit than a well-worn benchtopfrom a brilliant and busy maker Trang 201 Organizing esults from studies about organization and creativity are all over the map Some suggest thatorganization leads ... Trang 213: Molding and Casting14: Sanding and Finishing Trang 320: Safety and First Aid21: Miscellaneous Continuing the Conversation Index Trang 4Tips and Tales from the WorkshopA Handy Reference ... circular, compartment canvas bags that have a cinch-rope top They can hold a lot, don’t take up a lot of space,and are easy to grab and go Even a really decent, heavy-duty one costs under US$25 and
Ngày tải lên: 04/03/2019, 10:43
The complete options trader a strategic reference for derivatives profits
... sound because the tangible supply and demandfactors make sense In a market craze or panic, prices change quickly and irrationally In the tulipmania example, there was no rational reason for anyone ... hired at a low price because no one bid against him When the harvest-time came, and many were wantedall at once and of a sudden, he let them out at any rate which he pleased, and made a quantity ... optionsmarket with guaranteed settlement and standardization of price, expiration , and contract size for calloptions The Options Clearing Corporation (OCC) was also created to act as guarantor of all
Ngày tải lên: 30/01/2020, 08:42
A decision model for an inventory system with two compound Poisson demands
... Industrial Engineering, Universitas Atma Jaya Yogyakarta, Yogyakarta 55281, Indonesia b Industrial and Manufacturing Engineering, Asian Institute of Technology, Pathumtani 12120, Thailand C ... conducted big data analytics on the transaction data of a final product in a factory warehouse After going through various analytics processes, we cannot conclude that the demand for this product ... & Industrial Engineering, 115, 319-330 Wang, G., Gunasekaran, A., Ngai, E W., & Papadopoulos, T (2016) Big data analytics in logistics and supply chain management: Certain investigations
Ngày tải lên: 26/05/2020, 23:06
Development of a 13mhz cavity for an rf implanter
... careful management of high voltage maintenance, insulation, and safety concerns.1.2.2 The tandem accelerators-based implanter The tandem accelerator generates a beam using a negative ion source at ... turns, and pitch angle, which indicates the angle of the helix's tangent relative to a plane perpendicular to its axis In helical coordinates, the wave equation cannot be separated, and a rigorous ... subsequently accelerated back to ground level, enabling efficient ion acceleration and manipulation.MV terminal potential can produce 2 MeV beams Since more than two electrons Tandem accelerators can generate
Ngày tải lên: 11/07/2021, 16:27
Using the National Collegiate Conference as a focal point for an AITP student chapter’s annual activities
... for Instead, the users select an index or a database and are taken to a data-base’s login page for which they do not have a username and password to gain access These databases are proprietary ... interest and participation or real world problems and solutions There are many benefits to the establishment and explo-ration of an annual theme and the educa-tional component of AITP student chapter ... Trang 1Using the National Collegiate Conference as a focal point for an AITP student chapter’s annual activities Johnny Snyder josnyder@mesastate.edu Gayla Jo Slauson gslauson@mesastate.edu
Ngày tải lên: 17/10/2022, 23:59
p-tech-a-new-model-for-an-integrated-engineering-technology-education
... program, are electrical engineer technician, mechanical engineering technician and medical imagining technician The annual salaries and unemployment rates are $59,800, $53,500, $49,300 and 2%, ... Attendance Rates Attendance Average, 1st Marking Period Attendance Average, 2nd Marking Period Trang 88 While more data are necessary to draw a definitive conclusion, student proficiency data ... such as AMD/Global Foundries and Solar City have relocated to New York due to the state investments and policy changes [14] The Capital Region of NYS is an area where there is a higher than average
Ngày tải lên: 23/10/2022, 01:32
Create a positive environment for primary students to acquire english
... Party and State, education is aimed at fully developing people to satisfy the common demand of industrialization and modernization Foreign languages in general and English in particular play an ... There are two kinds of material languages which almost every learner needs develop: receptive language and productive language Receptive language is the language factor possibly realized and not ... Trang 1EDUCATION AND TRAINING THANH HOATHACH THANH DEPARTMENT OF EDUCATION AND TRAINING INITIATIVE EXPERIENCE CREATE A POSITIVE ENVIRONMENT FOR PRIMARY STUDENTS TO ACQUIRE ENGLISH Performed
Ngày tải lên: 26/10/2022, 05:35
Create a positive environment for primary students to acquire english
... Party and State, education is aimed at fully developing people to satisfy the common demand of industrialization and modernization Foreign languages in general and English in particular play an ... There are two kinds of material languages which almost every learner needs develop: receptive language and productive language Receptive language is the language factor possibly realized and not ... Trang 1EDUCATION AND TRAINING THANH HOATHACH THANH DEPARTMENT OF EDUCATION AND TRAINING INITIATIVE EXPERIENCE CREATE A POSITIVE ENVIRONMENT FOR PRIMARY STUDENTS TO ACQUIRE ENGLISH Performed
Ngày tải lên: 28/10/2022, 04:44
Create a positive environment for primary students to acquire english
... Party and State, education is aimed at fully developing people to satisfy the common demand of industrialization and modernization Foreign languages in general and English in particular play an ... There are two kinds of material languages which almost every learner needs develop: receptive language and productive language Receptive language is the language factor possibly realized and not ... Trang 1EDUCATION AND TRAINING THANH HOATHACH THANH DEPARTMENT OF EDUCATION AND TRAINING INITIATIVE EXPERIENCE CREATE A POSITIVE ENVIRONMENT FOR PRIMARY STUDENTS TO ACQUIRE ENGLISH Performed
Ngày tải lên: 29/10/2022, 04:45
existence of a positive solution for quasilinear elliptic equations with nonlinearity including the gradient
... Lebesgue measure of , and where Cand λare positive constants as in (A) and Lemma , respectively. Proof Fix any ε > and choose any ρ > By taking (u ε+ρ) –pas a test function, we obtain ... nonnegative The results in [] and [] are applied to the m-Laplace equation with an (m – )-superlinear term f w.r.t u Here, we mention the result in [] for the p-Laplacian Faria, Miyagaki and ... Trang 1R E S E A R C H Open AccessExistence of a positive solution for quasilinear elliptic equations with nonlinearity including the gradient Mieko Tanaka* * Correspondence: tanaka@ma.kagu.tus.ac.jp
Ngày tải lên: 02/11/2022, 10:38
Citrate accumulation related gene expression andor enzyme activity analysis combined with metabolomics provide a novel insight for an orange mutant
... CGAGCAGCAACAGCGACAAGA CCACAGACCCCAGGAAAACGA Ciclev10024946m VHP2 TGAGCCACAGAATCAGAGAGAGAA GCACCAACAATCAAACCAATAAAC Ciclev10007524m VHP3 CCCTGCACATACAACACAG TGCTGACTCCTTTCCTTGCT orange1.1g040141m ... TTTGGGATGCTCAGTTGTGA CTGAATGGCTCCCAAAAATG orange1.1g018391m GS3 TCAGGATTCACGAGTTCACG AGCAAAGAACCCACTGTTGC orange1.1g018434m GAD1 glutamate decarboxylase CACCAAAAAGAATGAGGAGACC CCGTACTTGTGACCACTGACAT Liu et al.31 ... TCACACCCAGAAGCATTGGAC ACLβ ATP-citrate β subunit GAGGAGATAACAGAGACAAA AACAAAGAGCCCATTCAGAT GS1 glutamine synthetase CATCAATGCTATCGCGTGTT TCTGCATTCTTGGCAGGTTA orange1.1g013478m GS2 TTTGGGATGCTCAGTTGTGA
Ngày tải lên: 19/11/2022, 11:49
phylogenic analysis of adhesion related genes mad1 revealed a positive selection for the evolution of trapping devices of nematode trapping fungi
... data, carried out analyses and wrote the draft manuscript Y.L and H.Z contributed to data analyses All other authors helped in interpretation of data and discussion of results All authors read ... (Perkin-Elmer, USA) Sequence assembly was performed using the SeqMan software (DNA Star software package, DNASTAR, Inc USA) and DNAman software package (Version 5.2.2, Lynnon Biosoft, Canada) Conserved ... tree, and MrBayes 3.1.238 was used to perform Bayesian analysis The Maximum Likelihood (ML) analysis was performed using PHYML 3.039 In the NJ analysis, pairwise deletion option for gaps was used
Ngày tải lên: 04/12/2022, 16:01
Đồ án tốt nghiệp Công nghệ kỹ thuật nhiệt: Design a control panel for an oil-fired boiler using PLC S7-1200
... programming language that meets the IEC 61131-3 standard ST is a text-based language, whereas LAD (Ladder Diagram) and FBD (Function Block Diagram) are graphical-based languages ST is a high-level ... high-level language similar to Basic, Pascal, and C - Highly organized with the capability to perform complex mathematical calculations - Allows programming of certain functions that are not available ... algorithms PLC programming language LAD (Ladder Diagram): Ladder Logic, also referred to as ladder diagram (LD) or LAD, is a graphical programming language used for programming Programmable Logic Controllers
Ngày tải lên: 20/12/2024, 11:02
Exploring consumers’ motives and behavioral intention to use green packaging a positive sign for sustainable consumption behavior in the future
... approach, comprising a main survey and data analysis This research was conducted in two phases: preliminary and formal quantitative research Initially, the author performed preliminary research ... packaging.At the same time, analyze assumptions and previous research models to build a foundation for reasoning and forming a research model.Presenting the research process, qualitative and quantitative ... collect data Utilizing online platforms such as Facebook, WhatsApp, LinkedIn, and email, Kumar et al (2019) successfully gathered 340 responses, with 331 participants' data available for analysis.Research
Ngày tải lên: 08/03/2025, 06:18
Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes
... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... drawer may prohibit presentment for acceptance He may al so stipulate that presentment for acceptance 75 shall not take place before a named date Unless the drawer has prohibited acceptance, every ... to act The same rule applies to a representative who has exceeded his powers Article The drawer guarantees both acceptance and payment 33 34 He may release himself from guaranteeing acceptanceevery...
Ngày tải lên: 22/10/2013, 10:15
Trade Finance Guide A Quick Reference for U.S. Exporters pptx
... receiving bank’s name and address, SWIFT (Society for Worldwide Interbank Financial Telecommunication) address, and ABA (American Banking Association) number, as well as the seller’s name and address, ... fully transferable, can be securitized, and are available in certain foreign currencies • Loans have a faster documentation process with the assistance of commercial banks • Cash payment financing ... exports ATFA and IFA are associations of financial institutions dedicated to promoting international trade finance through forfaiting ATFA is located in New York, and its Web site is www.afia-forfaiting.org...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: "A Revised Design for an Understanding Machine" doc
... the essentials of human understanding of language would seem to be of no small importance And for mechanical translation, if we really want fully automatic, high quality translation, I can see no ... Ceccato, Silvio; and Maretti, Enrico, “Classifications, Rules, and Code of an Operational Grammar for Mechanical Translation,” in Kent, Allen (Ed.), Information Retrieval and Machine Translation, Interscience ... situation, we can always view that meaning as based on his comparing his sensory input against appropriate mental standards The fact that such a view of meaning may be highly artificial and in fact useless...
Ngày tải lên: 23/03/2014, 13:20
the extracted mba a topical reference for the contemporary mba
... organizational culture and quality of life in an organization Trend analysis: An approach to forecast labor needs based upon organizational performance indexes Management forecasts: Forecasts ... broad span of management Organizational change: The adoption and implementation of innovations and new behaviors by an organization Reactive change: Changes that occur after external forces have ... The Extracted MBA Peer appraisal: Evaluation of an employee s performance by coworkers at the same level Team appraisal: TQM-based appraisal that evaluates team performance rather that that of...
Ngày tải lên: 02/04/2014, 18:17