podcast like a pro from your mac

Create Your Own Blog: 6 Easy Projects to Start Blogging Like a Pro pptx

Create Your Own Blog: 6 Easy Projects to Start Blogging Like a Pro pptx

... Copy Editor Barbara Hacha All terms mentioned in this book that are known to be trademarks or service marks have been appropriately capitalized Sams Publishing cannot attest to the accuracy of this ... to.) As you can see, you can have a domain that people will recognize (trishussey.com) and a blog that maintains a sense of branding I could have also bought aviewfromtheisle.com and used that all ... Penmachine.com, with his final post YOUR BLOG AS YOUR DIGITAL LEGACY In May 2011, the Internet lost a great treasure, and I lost a friend Derek K Miller was just 41 when he passed away from cancer,...

Ngày tải lên: 28/06/2014, 17:20

288 1,8K 0
Cook Like a Pro

Cook Like a Pro

... individual tarts, cakes, and other sweet and savory baked goods Like tart pans, these are available with both stationary and removable bottoms and regular and nonstick finishes You’ll find tartlet pans ... fillings from scorching Glass (bottom) Made from heat-resistant Pyrex, glass pie dishes, also called pie plates, are a popular and attractive choice The primary advantage of glass is that it lets ... are typically 10 or 11 inches (25 or 28 cm) in diameter Quiches can also be made in metal tart pans (see below) d TART PANS Metal tart pans have shallow, usually fluted sides and are available in...

Ngày tải lên: 15/01/2014, 12:17

25 357 0
Trade Like a Pro ppt

Trade Like a Pro ppt

... UP YOUR APPROACH TO THE MARKETS When making the transition from operating like a retail trader to operating like a professional trader, retail traders need to go from being haphazard in their approach ... trade like a professional trader, you have to take a different approach to what the markets mean to you in relation to the capital you put in and what you hope to achieve From Retail Trader to Professional ... motivations, financial attitude, and psychological makeup made them operate more like amateurs with access to a lot of money, as opposed to professional traders with a strict agenda and plan These...

Ngày tải lên: 06/03/2014, 00:20

288 1,4K 0
Shoot Like a Pro! DIGITAL PHOTOGRAPHY TECHNIQUES ppt

Shoot Like a Pro! DIGITAL PHOTOGRAPHY TECHNIQUES ppt

... the angle of view and the size at which your subjects appear At a short focal length, you can capture a wide area, but objects appear smaller and farther away At a long focal length, the opposite ... a particular focal length, and image sensors are much smaller than film negatives To capture the same image as a film camera, a digital camera needs a focal length about one-sixth as long Further ... data in a standard format called EXIF, which stands for Exchangeable Image File Format, so that you can view it in any organizer that can speak the EXIF language Figure 1.10 gives you a look at...

Ngày tải lên: 11/03/2014, 19:20

256 938 2
harnect   programming like a pro for teens

harnect programming like a pro for teens

... languages Programming languages are the artificial languages that programmers use for creating software You saw that several programming languages are available, and they have a variety of characteristics ... Chapter n Getting Started What Is a Programming Language? A programming language is an artificial language that programmers use to communicate their solutions to a computer Programming languages ... contain special words and symbols that are organized in a systematic way to create a program in much the same way that you take the English language and create sentences and paragraphs for your...

Ngày tải lên: 19/03/2014, 14:06

433 1,7K 0
The Ultimate IFTTT Guide: Use the best web tool like a pro

The Ultimate IFTTT Guide: Use the best web tool like a pro

... automatically saved to your Dropbox account No manual selecting and manual uploading Take care of creating beautiful images; IFTTT will take care of them so that they are accessible on your computer ... off and an action takes place automatically on the other For example: let’s say that you are a photography fan who uses Instagram constantly throughout the day You love taking photos with your ... blazer after all Recipe #2 – Wake Up Call The result: You get a call at a time of your preference with an automated message What it’s good for: We’ve all been in a situation when an alarm clock...

Ngày tải lên: 20/03/2014, 00:07

71 474 1
one more zero. how to trade the forex like a pro in one hour

one more zero. how to trade the forex like a pro in one hour

... de l'antộrieur ộvaluer le bas de la barre avant une haute au-dessus de la haute de la barre antộrieure des prix 23 Merci M DeMark de partager cette information avec nous LACUNES Trouver jamais ... que le marchộ a cessộ de monter.Une approche plus dộfinitive dộclare cela la rộsistance est la semaine avant haute et l'appui est la semaine avant basse.Si tu emploies les signaux marchands pour ... dans cette table Australian Dollar $FXAU Brazilian Real $FXBR Canadian Dollar $FXCA Chinese Yuan $FXCN Denmark Krone $FXDK EMU Members Euro $FXEU Hong Kong Dollar $FXHK Indian Rupee $FXIN Japanese...

Ngày tải lên: 23/04/2014, 15:51

55 640 0
How to teach young learners like a pro

How to teach young learners like a pro

... I like to eat, eat, eat apples and bananas I like to eat, eat, eat apples and bananas I like to ate, ate, ate ay-ples and ba-naynays I like to ate, ate, ate ay-ples and ba-naynays I like to eat, ... the scrabble squares A variety of different games can be made from this An idea would be to get an article and jot down the unfamiliar vocabulary As an activity for afterwards, play a game involving ... students can generate ideas for a nonfiction paragraph with a simple star organizer Have your students draw a large, five pointed star on one side of a piece of paper If you have already talked about...

Ngày tải lên: 30/06/2015, 23:50

28 891 3
HOW TO TEACH ADULTS LIKE A PRO

HOW TO TEACH ADULTS LIKE A PRO

... language naturally much faster than adults This isn’t to say, however, that adults aren’t capable of learning either Many have already been in school and had a go at learning a second language ... speaking English in class, rather than breaking into discussion groups in their primary languages, say that as well, and give a reason HAVE A PLAN Have a plan Break course objectives down and have ... appreciate hands on and practical uses for English You should use as many authentic materials as your students can handle, and put them in realistic situations to practice language Rather than staging...

Ngày tải lên: 02/08/2015, 04:49

38 624 1
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... an amino acid at a particular position for this family of plant cysteine proteases The primers used were 5¢-TTGCCTGAGCATGTT GATTGGAGAGCGAAAG-3¢ (forward) and 5¢-GGGAT AATAAGGTAATCTAGTGATTCCAC-3¢ ... cysteine protease ervatamin A from Ervatamia coronaria Acta Crystallogr F 61, 562–564 Kundu S, Sundd M & Jagannadham MV (2000) Purification and characterization of a stable cysteine protease ervatamin ... substrates are in bold Ervatamin -A Substrates N-benzoyl-Phe-Val-Arg-pNA D-Val-Leu-Lys-pNA D-Ile-Phe-Lys-pNA Ala-Ala-Val-Ala-pNA D-Ile -Pro- Arg-pNA Na-benzoyl-Arg-pNA D-Leu-Ser-Thr-Arg-pNA N-succinyl-Ala-Ala-Ala-pNA...

Ngày tải lên: 18/02/2014, 16:20

14 636 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... hydrogen bonds Main chain–main chain Main chain–side chain Side chain–side chain Total ˚ Exposed surface areab (A2 ) ˚ Apolarc (A2 ) ˚ Buried surface areab (A2 ) ˚ Apolarc (A2 ) a 1IC6 1THM 38 24 ⁄ ... Rms deviation from ideality ˚ Bonds (A) ⁄ angles (°) ˚ Average B-values (A2 ) Protein ⁄ water ⁄ PMSF ⁄ Ca2+ Ramachandran plotc Most favoured, additional, generously allowed (%) ˚ a ¼ 43.2 A ˚ b ... Smalas AO & Willassen NP (2003) The structure of uracil–DNA glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features Acta Crystallogr Sect D 59, 1357–1365 10 Aghajari N, Van...

Ngày tải lên: 19/02/2014, 16:20

14 597 0
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

... of the proteinase gene primers were designed from the sequence of Vibrio alginolyticus [42]: 5¢-GCGGAATTCTACACCCGCTACATGTGGCGTCG CCAT-3¢ and 5¢-CGCGGATCCTGGGGACTAGATC GAATC-GACCAACGTAA-3¢ Underlined ... TOPO TA CloningÒ Kit from Invitrogen was used for expression The gene was amplified with PCR from genomic Vibrio DNA using the primers 5¢-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3¢ and 5¢-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG ... pH (adjusted for each temperature), containing 100 mM NaCl, mM EDTA and 15 mM CaCl2, were heated and aliquots were withdrawn at intervals and immediately assayed for remaining activity against...

Ngày tải lên: 21/02/2014, 01:21

11 551 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... kDa metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and W ... Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification...

Ngày tải lên: 23/03/2014, 09:20

11 429 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... function as an AFP as well as its relationship to other CTLDs MATERIALS AND METHODS Materials N-Glycosidase F and endoproteinase Glu-C were obtained from Roche Molecular Biochemicals (Laval, Canada) ... use Approximately 2.5 mL plasma was fractionated on a · 90 cm S-200 Sephacryl (Pharmacia, Uppsala Sweden) gel-filtration column Fractions containing AFP, as determined by SDS/PAGE, were then applied ... expressed as mean ± SE Photographs of ice crystals viewed during these measurements were taken at a magnification of 200· Protease protection assays on smelt AFP Protease protection assays to compare...

Ngày tải lên: 24/03/2014, 03:21

8 519 0
Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

... channels and beyond: mechanisms of temperature sensation Nat Rev Neurosci 2003, 4:529-539 30 Amaya F, Oh-Hashi K, Naruse Y, Iijima N, Ueda M, Shimosato G, Tominaga Y, Tanaka Y, Tanaka M: Local inflammation ... SL, Hogaboam CM, Evanoff H, Strieter RM, Lukacs NW: Macrophage/fibroblast coculture induces macrophage inflammatory protein-1 alpha production mediated by intercellular adhesion molecule-1 and oxygen ... Chemicals, Ann Arbor, Michigan, USA) and for rat IL-6 (OptEIA; BD Biosciences, Heidelberg, Germany) Data analysis From each cover slip, 100 structurally intact and NSE-labelled neurones were examined...

Ngày tải lên: 09/08/2014, 10:20

12 186 0
Báo cáo y học: "Lichen planus-like eruption resulting from a jellyfish sting: a case report" pot

Báo cáo y học: "Lichen planus-like eruption resulting from a jellyfish sting: a case report" pot

... underneath an acanthotic epidermis with tapering rete ridges (Figure 2) Focally, a few mononuclear cells were seen infiltrating the basal layer, and vacuolar change of the basal layer was not ... with a three-week course of a twice daily topical application of betamethasone dipropionate (0.05%) cream is felt that dermatologists should be aware of this when dealing with cases of aquatic animal-induced ... persistent rubbing, granuloma, ulceration and necrosis [1] Rarely, gangrene, fat atrophy, scarring and contractures as well as pigmentary changes can also occur [2,3] Delayed cutaneous reactions in the...

Ngày tải lên: 11/08/2014, 17:21

3 215 0
báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

... Myr -A (5'-P-gatccatgggatgcttttcatgctgctgtgtggcagatgacgacaacgttggcaggaggaagaagcat-3') and Myr-B (5'-Pgatcatgcttcttcctcctgccaacgttgtcgtcatctgccacacagcagcatgaaaagcatcccatg-3') and ligation of the ... (5'-atgcgcgggcgactaaccctggagaacatg-3') and SP3 (5'-ccgagcctggaggcattctgttcaga-3') for ZmPti1b; SP7(5'-cgcaaccaccggcagccactactgacgcta-3') and SP8 (5'-taataaggtggtcacgaccgctg-3') for ZmPti1c; SP12 (5'-ctgcaccaaccaccgaagagccagctcca-3') ... http://www.biomedcentral.com/1471-2229/6/22 At3g62220 At3g17410 Arabidopsis thaliana Arabidopsis At1g48210 thaliana Arabidopsis At2g47060 Arabidopsis thaliana thaliana gi|51038251 Oryza sativa At1g48220 Arabidopsis...

Ngày tải lên: 12/08/2014, 05:20

22 324 0
A Call from the Dark

A Call from the Dark

... looked at him blankly Crass (Colin Sass was his real name, though nobody called him that) said nothing to me at all about having a package waiting for this guy ‘Don’t worry, I can come back,’ he said ... what was with that coat anyway? It was almost summer and I was only wearing a T-shirt Everything Robert wore was, in fact, black His tight jeans with the frayed seams, his faded Korn T-shirt and ... including a couple of cats, a goldfish and a white rabbit called Snow that Mum and Dad bought me for my ninth birthday that lasted about two weeks before it escaped and feasted on snail bait next...

Ngày tải lên: 06/11/2012, 16:13

11 472 0
A visit from a pen pal

A visit from a pen pal

... vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence (Sân nhà họ ngăn cách với nhà máy hàng rào cao.) -» separate (adj): riêng ... eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations: Hiệp hội nước Đông Nam Á Website học ... atmosphere over the party was warm and friendly (Không khí b a tiệc đầm ấm thân mật.) to pray (v): cầu nguyện; cầu khấn Ex: We all prayed that she would soon recover (Tất cầu nguyện cho cô mau...

Ngày tải lên: 17/01/2013, 09:58

5 1,7K 0
w