... Trang 1DESIGN ANALYSIS, INSTALLATION AND PERFORMANCE EVALUATION OF A HYDRAULIC RAM PUMP SYSTEM WITH A MODIFIED WASTE VALVE Danilo P Metra, Jr1, *, Marvin C Credo2 1 Department of Mechanical ... valve As a lot of studies had been carried out investigating parameters possibly affecting the performance of a hydraulic ram pump, this study aimed to design and fabricate a modified waste valve ... the target area of installation 2 MATERIALS AND METHODS 2.1 Ocular visit, problem inspection, and data collection An ocular visit of the target area for the installation was conducted and necessary
Ngày tải lên: 06/03/2020, 20:03
... CACAA-3’ (Reverse) for KRAS exon 2, 5’- GTAAAAC GACGGCCAGCCAGACTGTGTTTCTCCCTTCTCAG CCTCA-3’ (Reverse) for KRAS exon 3, 5’- GTAAA ACGACGGCCAGTCAGATCTGTATTTATTTCAGTG GCTATGACCGACTCTGAAGATGTACCTATGGTCC ... GCTATGACCGACTCTGAAGATGTACCTATGGTCC TA-3’ (Reverse) for KRAS exon 4 (K117N) and 5’-GT AAAACGACGGCCAGTAATGACATAACAGTTATGA (Reverse) for KRAS exon 4 (A146/VT/P) In this reac-tion, after an initial denaturation step at 95 °C ... supported data analysis P.P is the guarantor of this work and takes responsibility for the integrity of the data and the accuracy of the data analysis All authors read and approved the final manuscript.
Ngày tải lên: 20/09/2020, 01:25
Development and performance evaluation of a novel dynamic headspace vacuum transfer “In Trap” extraction method for volatile compounds and comparison with headspace solid-phase
... Theextractionratio(E)ofthemethodwasevaluatedbyextracting thesamesamplefivetimes.TheEvaluewascalculatedaccording toZimmermannetal.,byplottingthelogarithmicalpeakareas againstthenumberofextractionandasimplifiedEq.(2)[30] ... constructedmatrix(ACM).Weassessthemethod’ssensitivity,and itssuitabilityforthequalitativeandquantitativeanalysisofabroad rangeofvolatilecompounds,smallsamplevolume,andlarge sam-pleseries.ThesuitabilityandefficiencyofDHS-VTTwereverified ... syringetemperature,andtheheadspacevolumeextracted.Many commercialextractionpolymerswereevaluatedbyLaaksetal.[14] andareavailableonthemarket.Thetrapcanalsobefilledwith noncommercialsorbents,suchasmultiwalledcarbonnanotubes orpolystyrene-divinylbenzene[1,9,15].Thechoiceofthesorbent
Ngày tải lên: 25/12/2022, 00:42
A hybrid unsupervised learning and multi-criteria decision making approach for performance evaluation of Indian banks
... aspects of bank performance reflected through a significant number of ratios It has been a popular approach for evaluating bank performance and recommending measures for bank stability (Ayadi et al., ... of Indian banks Soumendra Laha a and Sanjib Biswas b* a St Xavier’s College (Autonomous), 30, Mother Teresa Sarani, Kolkata – 700016, India b Calcutta Business School, Diamond Harbour Road, Bishnupur ... integrated approach in assessing performance of selected public and private sector bank We have applied Combinative Distance-based Assessment (CODAS) approach for understanding their comparative performance
Ngày tải lên: 16/01/2020, 16:45
A benchmarked evaluation of a selected capitalcube interval scaled market performance variable
... computations and Trang 8demonstrate the logic of the RAE as a generalizable benchmark of forecast acuity With this as context consider now the inferential analysis of the CCPL as a CCMNP variable of ... Trang 1A Benchmarked Evaluation of a Selected CapitalCube Interval-Scaled Market Performance Variable Edward J Lusk1 1 The State University of New York (SUNY) at Plattsburgh, 101 Broad St., ... scaled to the fuzzy-interval: [0 to 1] As a long-memory filter in the Moving Average class, prima fascia, it would lack the temporal sensitivity to qualify as a reasonable evaluation of TP acuity
Ngày tải lên: 16/01/2020, 17:46
A multi-criteria decision making approach to performance evaluation of mutual funds: A case study in Serbia
... [40]), Ishizaka and Labib [22], andSubramanian and Ramanathan [41] DEA ([8], [9]; [11]; [12]; [17]) is a mathematical, non-parametric approach forcalculating efficiency, based on linear programming, ... efficiency of American mutual funds using the DEA methodcriteria was measured by Anderson et al [2] and Daraio and Simar [13] Galaged-era and Silvapulle [19] used DEA methods to assess the relative ... critical value:3.2 DEAHP approach Ramanathan [33] proposes a hybrid DEAHP ([25], [21], [42],[22], etc.) method as a way to overcome the shortcomings of the partial application of DEA andAHP methods
Ngày tải lên: 03/02/2020, 21:02
Design, development and performance evaluation of manure spreader- A review
... NaveenKumar, C., Prakash, K V., Anantachar, M., Veerangouda, M and Nagaraj N 2017 Performance Evaluation of Tractor Operated Farmyard Manure Spreader Res J of Agric Sci 8: 816-820 Patil, S T and Munde, ... Trang 10of animal operated farm yard manure applicator Int J Agric Engg 6: 519-523 Sapkale, P R., Mahalle, S B and Bastewad, T B 2010 Performance evaluation of tractor operated manure spreader ... irrigated lowland rice J Plant Nutri 25: 2081-2090 Sharabasy, M M A., Ali, M M A and Afify, M K 2007 Manufacturing and evaluation of a self-propelled machine for broadcasting seeds and granular
Ngày tải lên: 11/03/2020, 12:00
potential of a modern vector supercomputer for practical applications performance evaluation of sx ace
... This paper is an extended version of a following poster papers of SC14 and SC15 R Egawa, S Momose, K Komatsu, Y Isobe, H Takizawa, A Musa and H Kobayashi,: “Early Evaluation of the SX-ACE Processor,” ... Section3evaluates thenew features of SX-ACE using several standard benchmark programs Section4dis-cusses the sustained performances and scalabilities of seven practical applications andthe HPCG benchmark ... 256 GB/s ADB is asoftware controllable private cache with 4 ways and 16 banks While the features ofADB are similar to those of conventional caches, ADB can selectively store reusabledata or explicitly
Ngày tải lên: 04/12/2022, 16:06
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... fracture may have been avoided in the case of an abnormal bone structure and a deformed endomedul-lary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation ... mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration analysis technique for the assess-ment of the ... modal analysis J Biomech Eng 1983, 105(3):244-248. 11. Nikiforidis G, Bezerianos A, Dimarogonas A, Sutherland C: Monitor-ing of fracture healMonitor-ing by lateral and axial vibration analysis.
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt
... Institute, Kampala, Uganda Variable Total Undetectable viral load N = 447 Detectable viral load N = 49 Odds ratio P-value Sex Non-HAART ever Hx of maternal nevirapine Selfpay for ART Missed ART in last ... Waters L, Kambugu A, Tibenderana H, Meya D, John L, Mandalia S, Nabankema M, Namugga I, Quinn TC, Gazzard B, Reynolds SJ, Nelson M: Evaluation of filter paper transfer of whole-blood and plasma ... antiretroviral anarchy in sub-Saharan Africa Lan-cet 2001, 358:410-414. 42 Koizumi Y, Ndembi N, Miyashita M, Lwembe R, Kageyama S, Mbanya D, Kaptue L, Numazaki K, Fujiyama Y, Ichimura H: Emergence of antiretroviral
Ngày tải lên: 20/06/2014, 08:20
Báo cáo toán học: " Recursive analytical performance evaluation of broadcast protocols with silencing: application to VANETs EURASIP Journal on Wireless Communications and " pptx
... (PPP), that allows to accurately modelthe real characteristics of the road topology Despite its apparent simplicity, the derivation of an analyticalperformance evaluation framework based on the assumption ... Section 7, after the validation of the analytical framework by means of numericalsimulation, the performance of the novel probabilistic broadcast protocols is investigated and compared withthat of other ... 1} as mandated by the IEEE 802.11 standard (Section 4) 6 A recursive analytical performance evaluation framework In Section 2, it has been stated that, since all TDs are statistically identical,
Ngày tải lên: 20/06/2014, 20:20
Báo cáo toán học: " Performance evaluation of space-time-frequency spreading for MIMO OFDM-CDMA systems" pptx
... Trang 1R E S E A R C H Open AccessPerformance evaluation of space-time-frequency spreading for MIMO OFDM-CDMA systems Haysam Dahman*and Yousef Shayan Abstract In this article, we propose a multiple-input-multiple-output, ... Trang 7MUI dominates channel noise, Equation (27) can beapproximated asΓ = Fa,b Now, by assuming all users are scheduled to transmit at similar symbol rates Rs at a time instance, we could calculate ... take advantage of the entire frequency spread of a particular bit, that adds to overall system hardware com-plexity In our proposed open-loop MIMO OFDM-CDMA, RAKE receiver is not needed as each
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " Evaluation of a TDMA-based energy efficient MAC protocol for multiple capsule networks" pot
... the advantages of simplicity, small overhead, small latency, etc TRAMA [11] and LMAC [12] are typical schedule-based MAC protocols Compared with conten-tion-based MAC protocol, schedule-based MAC ... and temperature sampled data may be smaller in size and lower in sampling rate than the real time image data Finally, unlike most WSN, multiple capsule networks operate only within the area of ... capturing and transmitting images with a frame rate of 2 frames/s [3] Efficient utilization of the limited energy is an issue It is a well known fact that the radio transceiver consumes a large part of
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " Research Article Performance Evaluation of Uplink Delay-Tolerant Packet Service in IEEE 802.16-Based Networks" potx
... The arrival flows have constant rate ofλ = λ/N and ω = 1/N for all the SSs Assuming fixed Trang 9Table 1: Basic evaluation parameters.Total capacity per frame for all SSs 30 packets UGS capacity ... the analytical model to perform an efficient dynamic capacity allocation, in which the nonreal-time (delay-tolerant) traffic of each Subscriber Station (SS) can utilize a portion of the spare bandwidth ... statej to state k in the above defined Markov chain The probability that the actual accumulated available capacity for the i-packets during a polling cycle isn equals P(H i(L) = n) Assuming that
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf
... position All these data are then postpro-cessed by the AnaVANET software AnaVANET is a Java application which traces all data packets transmitted or forwarded by mobile routers It thus detects packet ... every packet being encapsulated and decapsulated both at MR and HA (3) Bottlenecks in HA is an important problem, since a significant amount of traffic for MNNs is aggregated at HA, particularly ... physical link and network layers in vehicular communications, there is an important lack of real evaluation analysis Many VANET solutions and protocols could be considered as nonpractical designs
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf
... with a total price of 150 euro), (2) it is not suited for a whole testbed, and (3) Trang 103A31 3A4 3A7 3A11 3A14 3A18 3A22 3A26 3A28 3A10 3A20 3A21 3A19 3A15 3A8 3A2 3A16 3A9 3A6 3A3 3A23 3B52 ... amount of charge (Q) stored at a given voltage drop (across the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance are measured in microfarads or picofarads) 5.2.1 ... 4 categories: green=best, yellow, orange, and red (worst) The blue node is the controller 3B45 3A31 3A4 3A7 3A11 3A14 3A18 3A22 3A26 3A28 3A10 3A20 3A21 3A19 3A15 3A8 3A2 3A16 3A9 3A6 3A3 3A23
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article Evaluation of a Validation Method for MR Imaging-Based Motion Tracking Using Image Simulation" ppt
... reference data and the validation method may lack an appropriate reference This paper evaluates a validation method using simulated MR image data This provided an appropriate reference and allowed ... than T the weight w a =0 2.4 Evaluation of Marker Tracking Method Using Simulated Magnitude MR Image Data The marker tracking method was evaluated using simulated magnitude MR image data because ... tetrahedron shown inFigure 4(b) All other appearances can be obtained by rotation and mirroring of the appearances in this tetrahedron Appearances 1–4 are the most symmetric appearances obtainable
Ngày tải lên: 21/06/2014, 19:20
báo cáo hóa học:" Research Article Performance Evaluation of UML2-Modeled Embedded Streaming Applications with System-Level Simulation" pdf
... formulation of the performance metamodel is carried out Trang 63.1 Application Performance Metamodel Application A isdefined as a tuple where T is a set of tasks, Δ is a set of channels, E is a set of ... between UML activity diagrams and streaming data application workload models and successfully adopts it for embedded RTES performance evaluation 3 Performance Metamodel for Streaming Data Embedded ... describ-ing the application and platform for performance evaluation Trang 3One possibility is to utilize abstract specifications Thismeans that application workload and performance of the platform resources
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: "Performance evaluation of time-multiplexed and data-dependent superimposed training based transmission with practical power amplifier model" doc
... Finally, diag(a) = diag(a1 , , an ) is an (N × N) diagonal matrix whose nth entry is an and diag(A) is a (N × 1) vector with values from the main diagonal of A, which is a (N × N) square matrix ... value, amax, the maximum amplitude value of the used constellation A, defined as {amax =max(|(d)|), d ∈ A, σ2= 1} We use this value because we wanted to achieve similar type of PAPR behavior as ... Trang 1Performance evaluation of time-multiplexed and data-dependentsuperimposed training based transmission with practical power amplifier model Toni Levanen∗, Jukka Talvitie and Markku Renfors
Ngày tải lên: 21/06/2014, 23:20
Performance evaluation of a solar assisted heat pump drying system
... and analyzed a heat-pump dryer taking into account several important variables, such as ambient condition, ratio of recirculated air, the evaporator air by-pass ratio , the total mass flow rate ... of evaporatorcollector and air collector, tests were conducted according to the ASHRE standard For the evaluation of performance of the system, solar fraction (SF) and coefficient of performance ... demonstrated the performance of the system as a function of collector area Thermal storage volume was evaluated to determine the fraction of the space heating and domestic hot water load that was...
Ngày tải lên: 28/11/2015, 13:43