organic synthesis and polymer modi cation

... sinh hiện đại Chủ đề: Alkali- and Halo-tolerant Catalase from Halomonas sp SK1: Overexpression in Escherichia coli, Purification, Characterization, and Genetic Modification Biosci Biotechnol Biochem ... KHẢO1 Phucharoen, K., Hoshino, K., Takenaka, Y., and Shinozawa, T., Purification, characterization, and gene sequencing of a catalase from an alkali- and halo-tolerant bacterium, Halomonas sp SK1 ... gấp cuộn,… (Yujin E Kim, Mark S Hipp, Andreas Bracher, Manajit Hayer-Hartl, and F Ulrich Hartl 2013

Molecular Chaperone Functions in Protein Folding and Proteostasis Annual Review of Biochemistry

Ngày tải lên: 29/09/2016, 17:10

... University – Ho Chi Minh City with the title “Synthesis of silica-based reverse-phase material possessing octadecyl groups (C18) and polymer-based strong cation-exchange material containing sulfonate ... (SPE)” has impressive achievements both in education and science After the study we end up with procedures to synthesize these two sorbents with ligand densities comparable or even higher than ... liệu pha đảo chưa nhóm octadecyl (C18) trên nền silica và vật liệu trao đổi cation mạnh chưa nhóm sulfonate trên nền polymer dùng làm pha tĩnh cho cột chiết pha rắn (SPE)” đã thu được kết quả

Ngày tải lên: 23/01/2021, 10:01

... Photochemistry and organic synthesis (Topics in current chemistry; 129) Bibliography: p Includes index 1 Photochemistry - Addresses, essays, lectures 2 Chemistry, Organic - Synthesis - Addresses, ... Boschke Trang 2Photoche~st~ and Organic Synthesis With Contributions by G S.Cox, K Dimroth, J-E Labarre, M A Paczkowski, M B Rubin, N J Turro With 91 Figures and 50 Tables Springer-Verlag ... (entry 1, ~max 440 nm, AIP 1.84 eV) and tetramethylcyclobutanedione (entry 5,492 nm, 2.08 eV) on the one hand and skewed di-t-butyldiketone (entry 2, 362 nm, 1.99 eV) and tetramethylcyclooctanedione

Ngày tải lên: 31/05/2014, 01:19

... thatrequire deftness and care in handling Experiments have been drawn from the standardliterature of organic synthesis including suitable modifications of several of the reliableand useful preparations ... excellent texts and reviews exist that provide thorough and curate discussion of the more theoretical aspects of organic synthesis, and the student isreferred to these sources and to the original ... Moriarty and H G Walsh, Tetrahedron Lett., p 465 (1965). 14 M A Naylor and A W Anderson, / Org Chem 18, 115 (1953). 15 H Nakata, Tetrahedron 19, 1959 (1963). 16 L M Berkowitz and P N Rylander,

Ngày tải lên: 04/06/2014, 15:24

... acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Synthesis and characteristics of NH2-functionalized polymer films to align and immobilize DNA molecules ... distribution, and reproduction in any medium, provided the original work is properly cited. 1 Synthesis and characteristics of NH 2 -functionalized polymer films to align and immobilize ... Weibel DE, Vilani b C, Habert AC, Achete CA: Surface modification of polyurethane membranes using RF-plasma treatment with polymerizable and non-polymerizable gases Surf Coat Tech 2006, 201:4190

Ngày tải lên: 20/06/2014, 23:20

... low- frequency side of the 875 and 711 cm -1 band indicates a minor amount of aragonite that has characteristic doublet bands in such frequencies [18]. The broad band of mag- netite at 595 cm -1 ... 3? / Fe 2? ratio change and defects. The bands at 2,923 and 2,852 cm -1 are due to EtOH used for IR sample preparation. The Raman shifts of coexisting calcite, aragonite and magnetite were shown ... with water [33] and Fig. 7 a Lattice image, b and c 2-D forward and inverse Fourier transform, respectively, of the square region in (a) showing well- developed (1 " 210) and {1 " 104}

Ngày tải lên: 21/06/2014, 08:20

... over zeolites is that the dimensions and topology of channels can be tuned through organic synthesis by modifying the molecular structure of the organic ligands that bridge the metal ions Another ... continuing design and synthesis MOFs composed of 4-(imidazole-1-yl)benzoic acids to expand our knowledge about 4-(imidazole-1-yl)benzoic acid MOF family A series of ligands are synthesized and Cu MOF-3N, ... 19 2 Design of Metal-Organic Frameworks Based on 4-(Imidazol-1-yl)benzoic Acids 24 2.1 Strategy and Objectives 24 2.2 Synthesis of ligands 27 2.3 Hydrothermal synthesis of MOFs 34 2.4

Ngày tải lên: 02/07/2014, 12:59

... Trang 1NANOSCALE METALORGANIC FRAMEWORKS: SYNTHESIS AND APPLICATION OF BIMODAL MICRO/MESO-STRUCTURE AND NANOCRYSTALS WITH CONTROLLED SIZE AND SHAPE Trang 3Résumé Les composés ... in research on porous inorganicorganic hybrid materials that are known as metalorganic frameworks (MOFs) or porous coordination polymers (PCPs).1-4 The phrase “metalorganic framework” that ... 4.3 Results and discussion 91 4.4 Conclusions 100 4.5 Appendix 101 4.6 References 104 Chapter 5 Rational Synthesis of MOF Nanocubes and Nanosheets Using Selective Modulators and Their Morphology-Dependent

Ngày tải lên: 02/07/2014, 13:40

... Transfer and Energy Migration in PPETEs with Varying Receptor Loading 64 3.3.1 Synthesis and Characterization 70 Trang 14Chapter 4 A Highly Selective and Sensitive Inorganic/Organic Hybrid polymer ... associated with electronic communication between the receptors along the polymer backbone.13 The polymer structure also provide for facile structural modification and good processability Wires ... E-Chem; Dr Robert Ben and Dr Scott Handy for discussion about some synthesis when they were still in the department; Dr David Doetschman and Dr Steve Yang for the EPR experiment and related discussion

Ngày tải lên: 13/11/2014, 10:54

... Reactions and Reagents in Organic Synthesis, John Wiley and sons, Inc., New York, 1988; M B Smith, J March in March's Advanced Organic Chemistv, 51h ed., John Wiley and Sons, ... Plagens, Named Organic Reactions, ... Vocabulary of Organic Chemistv, John Wiley and Sons, Inc., New York, 1980; A Hassner, C Stumer, Organic Syntheses Based on Name Reactions and UnnamedReactions, ... McElvain, Organic Reactions, 4,4; J P Schaefer, J J Bloomfield, Organic Reactions, 4, 15; J J Bloomsfield, J M Owsley, J M Nelke, Organic Reactions 23,2 The Riihlmann modification (Bouveault-Blanc

Ngày tải lên: 07/08/2015, 18:04

... hollow polymer micro- and nanospheres with novel morphology and functions via a combination of inorganic and polymer synthesis and optimize the applications of these hollow polymer ... HYBRIDS AND POLYMER HOLLOW STRUCTURES: SYNTHESIS, CHRACTERIZATION AND APPLICATIONS LI GUOLIANG M. Sci., Polymer Chemistry and Physics Nankai University 2007 B. Eng., Polymer Science and Engineering ... living radical polymerization technique has been explored and exhibited a novel strategy for the fabrication of polymer brush-decorated inorganic/polymer core-shell hybrids and polymer hollow

Ngày tải lên: 10/09/2015, 08:40

... protein synthesis, and that the reduced protein synthesis leads to a decrease in the synthesis of DNA and RNA and to growth inhibition Finally we compared the activities of heIF5A wildtype and mutant ... mutagenesis of each conserved amino acid, and by truncation, tested them as substrates for DHS and DOHH, and assessed their activities in supporting growth and protein synthesis in an eIF5A null background ... (aIF5A)] and bacteria [elongation factor P (EF-P)] that share significant sequence identity and structural similarity with eIF5A [18] The hypusine modi cation has evolved in eukaryotes, as hypusine modi cation...

Ngày tải lên: 16/03/2014, 06:20

... structure of a modi ed citropin 1.1 (Eur J Biochem 270) 1143 Table Citropin 1.1 and synthetic modi cations Modi cations are shown in bold Relative molecular mass Citropin Sequence 1.1 1.1.2 Modi ed ... IC50 values of 29.6, 33.7 and 39.5 lgÆmL)1, hence we give the IC50 range as 30–40 lgÆmL)1 Qualitatively, this compound shows less nNOS inhibition than modi cations and Modi cations are shown in bold ... These include lesueurin [17], dahleins 1.1 and 1.2 [53] and some synthetic modi cations of lesueurin The solution structure of citropin 1.1 synthetic modi cation (A4K14-citropin 1.1) The solution...

Ngày tải lên: 17/03/2014, 09:20

... introduced in polymer synthesis, polymer characterization, and application of functional polymer supports This includes synthesis of structured polymer supports using living polymerizations and advanced ... in Organic Synthesis 312 Hyperbranched Polymeric Supports in Organic Synthesis 316 Other Soluble Multivalent Supports in Organic Synthesis 319 Dendronized Solid-phase Supports for Organic Synthesis ... Physical Formats and Characterization of Polymer Supports Yolanda de Miguel, Thomas Rohr and David C Sherrington Synthesis and Molecular Structure of Polymer Supports Suspension Polymerized Particulate...

Ngày tải lên: 03/04/2014, 12:15

... PAGE gel and Coomassie Blue staining, and the band corresponding to a modi ed OTUB1 (rectangle) was excised and digested with trypsin The peptide mixture was analysed by a nano-UPLC-QTOF tandem ... prepared and two forms of OTUB1 (31 kDa unmodified form and 37 kDa modi ed form) were visualized using OTUB1 antibodies (E) OTUB1 37 kDa form is phosphorylated HEK293T cells were lysed and incubated ... (EV) WT Y26E Y26F OTUB1 α-HA Fig OTUB1 modi cation controls its function and its effect on Yersinia invasion (A) Binding of YpkA to OTUB1 depends on OTUB1 modi cation Empty vector (EV control), OTUB1-HA...

Ngày tải lên: 16/02/2014, 15:20

... (RU) for each IVIg preparation (B) Reactivity of native (lines and 4), pH buffer-exposed (lines and 5) and pH 2.8 buffer-exposed (lines and 6) IVIg with Bacillus anthracis antigens The membranes ... compilation ª 2010 FEBS 3043 Molecular modi cations in low pH-exposed IgG I K Djoumerska-Alexieva et al molecules to an acidic milieu would result in structural modi cations Indeed, an increase in the ... (intensity and wavelength of the fluorescence maxima) depend on the polarity of the local protein environment Thus, changes in the positions of the fluorescent amino acids, caused by structural modi cations...

Ngày tải lên: 16/02/2014, 15:20

... known as the replication-dependent variants H1.1–H1.5 and Structure and function of the linker histone variants Location and structure of the linker histones Historically, the location of the globular ... Mutations and ampli cation of the androgen receptor gene, without loss of gene expression, play a key role in the development of advanced, androgen-independent prostate cancer [4] Methylation of the androgen ... human and mouse linker histones Speciation events are indicated by blue dots and gene duplication by red dots HIST1H1C and HIST1H1E are the genes that code for human linker histones H1.2 and H1.4,...

Ngày tải lên: 18/02/2014, 08:20

... Table We here concentrate on applications of COFRADIC in studying selected post-translational modi cations ) protein processing [34,36] and N-glycosylation [39] – and describe the use of COFRADIC ... chains, such as cysteinyl [80] and methionyl [32] moieties, to post-translational modi cations by phosphatase [37] and PNGaseF [39] treatments In another application, peptides located at the ... on an increasing set of protein modi cations [81,82] Such top-down techniques focus on complete proteins, allow detection of normally labile protein modi cations, and avoid several problems associated...

Ngày tải lên: 18/02/2014, 16:20

... one strand and two AG steps in the other The mdm2 target, whose interaction with p53 was most strongly affected by DNA cis-platination, contains GG, GGG and AG motifs in one strand and GG and GTG ... DNA modi cation with cisplatin on binding of the p73 proteins to the p21 and p21b target sites In the graph, squares correspond to p73b and triangles to p73d For other details, see Figs and under ... protein to unmodified PGM1, PGM4, p21 and p21b targets in the presence of unmodified or cis-platinated (rb ¼ 0.06) calf thymus competitor DNA revealed no apparent effect of the competitor modi cation...

Ngày tải lên: 19/02/2014, 05:20

... and GTCACTCGAGCTAAAGGCC CGTCTGGTGAATCAAG, respectively, and for b2 GTC AGCTAGCCCGTCCCTGTGACTGTGATG and GTC ACTCGAGCTAGGCTTGACAGCCTGCAGGG, respectively They were used for ampli cation by PCR and ... sieve and showed a broad electrophoretic band mainly in the range 70±110 kDa, which could be converted into the monomer and dimer bands after treatment with chondroitinase ABC (Fig 2, lanes and ... to DEAEcellulose and showed, after molecular sieve chromatography, a single band of 33 kDa (Fig 2, lanes 2), indicating its monomeric nature and lack of glycosaminoglycan modi cation Edman degradation...

Ngày tải lên: 21/02/2014, 03:20