objective c implementation of the quickconnectiphone architecture

Báo cáo " Non-commutative chern characters of the $C^*-$algebras of the sphers " ppt

Báo cáo " Non-commutative chern characters of the $C^*-$algebras of the sphers " ppt

... he structure of the paper In section 1, we compute the Chem chracter of the C*—algebras of spheres The computation of Chern character of C*(S”) is based on two crucial points: i) Because the sphere ... Chern characters of C’*—algebras of spheres In this section, we compute non-commutative Chern characters of C*—algebras of spheres Let A be an involution Banach algebra We construct the non-commutative ... algebraic vesion cheig : K.(C*(G)) —> HP,(C*(G))), which coincides with the Fedosov-Cuntz- Quillen formula for Chem characters [5] When A = C2(G) we first computed the K —groups of C2(G) and the

Ngày tải lên: 14/03/2014, 13:20

11 243 0
Báo cáo khoa học nông nghiệp " Achievements and lesson learnt from implementation of the project "Sustainable community-based forest development and management in some high-poverty areas in Bac Kan Province" " pot

Báo cáo khoa học nông nghiệp " Achievements and lesson learnt from implementation of the project "Sustainable community-based forest development and management in some high-poverty areas in Bac Kan Province" " pot

... identify the productivity as well as biodiversity The social economic condition of local community and the dependency of livelihood of local community on the forest were identified by socio-economic ... the community can access to CFDF as microfinance sources for forest development Trang 9Lessons learnt from implementation of CFM plan - Capacity building for local people on the rights to access ... implementation of CFM - Control free grazing in Bac Kan is a crucial factor for the success of the agro-forestry models and replantation in community forest lands - Clear demarcation of the community

Ngày tải lên: 21/06/2014, 04:20

10 335 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

... Generally the use of insecticides is a common practice by farmers to control insect pests. In some cases the efficacy of insecticides was not proven due to misuse and farmer use of insecticides ... and their conservation’, ‘The effect of weaver ants on the main cashew insect pests’, ‘The biology of weaver ants’, ‘The IPM principles’, and ‘Skills of communication and activation in class’ ... in the fallen leaves close to the bare soil, their population was eradicated by spraying the contact-killing insecticide (Motox® 5EC). Then new collected colonies of weaver were introduced

Ngày tải lên: 21/06/2014, 05:20

10 553 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

... the second 6 months of the project have been achieved The following are the achievements against each of the activities The first year TOT training has been progressing well since the start of ... management and the control of competitive species of ants in cashew orchards Because of the positive influence of this project in Vietnam, Charles Darwin University has made another commitment towards ... include the following 7 aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the use of weaver ants in cashew

Ngày tải lên: 21/06/2014, 06:20

12 532 1
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

... 4 Complete the draft of the cashew IPM curriculum, and 5 Complete the draft of the cashew IPM posters 9 Conclusion The proposed activities for the third 6 months of the project have been achieved ... needed for the course of communication skills, and (4) the effect of pesticides on human health and the environment should be given in the course of ‘The use of pesticides’ In conclusion, although ... ranking courses In terms of the confidence in using cashew IPM methods, 54% of the trainees chose ‘confident’ and 46% chose ‘good’ For the confidence in opening FFSs, 8% of them chose ‘very confident’,

Ngày tải lên: 21/06/2014, 06:20

24 454 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

... were conducted in Hong Loc centre, Hong Loc Centre orchard, Mr Sau’s orchard and some orchards in Dak Lac province The observations concentrated on the bio-ecology of the branch borer and the ... was concentrated on the 18 small trees The second survey was conducted in another block of the orchard in August 2007 in collaboration with a field practical of the TOT training This block was ... rearing were conducted in Hong Loc Centre to understand the behaviour and the life cycle of the branch borer and the stem-root borer, to select locally available soft chemicals to control thrips,

Ngày tải lên: 21/06/2014, 06:20

26 492 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

... especially the use of the weaver ant technology The results showed that all the TOT trainees (56 in the first year and 56 in the second year) successfully passed their examinations Each of them ... TOT trainers in each of the 10 cashew-growing provinces in Vietnam Number of TOT trainers Province 2 Objective assessment of the competence of 56 TOTs as trainers of another 56 TOTs Following ... lphlan@yahoo.com Trang 3Summary This competence evaluation has been done based on (1) the quality control of TOT training, (2) an objective assessment of the competence of 56 TOTs as trainers of another

Ngày tải lên: 21/06/2014, 06:20

10 304 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

... report, the executive summary consists of the summery of the 6th 6-monthly activities and the summary of the project achievements against the project objectives, outputs and activities In the last ... growing provinces 2 Complete all the field experiments in the demonstration orchards, 3 Complete the cashew ICI curriculum, 4 Complete the cashew ICI photo book, and 5 Conduct the second baseline ... from the CARD Office to print 3000 copies of the ICI photo book and 500 copies of the ICI manual book The aims of this project are to increase cashew yield and nut quality and improve the environment

Ngày tải lên: 21/06/2014, 06:20

37 395 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

... control efficiency by crematogaster ants is a new finding of this project 2 Executive Summary The proposed activities for the first 6 months of the project have been successfully achieved The following ... finding of this project A baseline survey was successfully conducted in eight main cashew growing provinces using a standard questionnaire The survey concentrated on the effect of current cashew ... against each of the proposed activities (in bold) of the logframe of our project proposal 4.1 Implementation Highlights I (i) Identification of regions within each of the 6 participating provinces

Ngày tải lên: 21/06/2014, 06:20

10 327 1
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 10 ppt

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 10 ppt

... chết Đôi khi chất độc đổi thành nước cam lồ Tất cả thuốc đều là chất độc, nhưng chúng là nước cam lồ cho người ốm Có tính luồng chảy trong cuộc sống, nhưng có tính cứng nhắc trong các qui tắc ... phương sách, cần cho việc điều chỉnh cuộc sống chúng ta; nhưng dần dần chúng ta trở nên bị mắc bẫy bởi chúng đến mức chúng ta cố gắng áp dụng chúng cho toàn thể bí ẩn của cuộc sống Chúng ta cố gắng ... di chuyển và nằm đối diện với cửa hàng của người bán kẹo Các qui tắc của logic là phi cuộc sống Cuộc sống là luồng sống động, luồng chảy Những người coi các qui tắc của logic là có giá trị và cố

Ngày tải lên: 22/07/2014, 00:20

12 316 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 9 potx

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 9 potx

... và cách thức để đi xuống nhưng không có cách nào được vạch ra để giúp cho con người đi lên Và không mục đích nào được phục vụ mà không có việc đi lên; không có cuộc hành trình đi lên không cái ... bắt đầu bốc lên Từ thời cổ đại các linh hồn cao hơn, các nhà huyền môn, đã hiểu rõ ràng về bản tính đi lên, bốc lên của lửa Tâm thức có thể tuôn chảy theo hai cách, giống như nước hoặc giống như ... dối trá của chúng con Chúng con cúi lạy ngài vô hạn lần Chúng ta đã thấy lạch và suối chảy từ núi xuống Chúng ta biết rằng sông chảy ra đại dương Nước bao giờ cũng chảy về mức càng ngày càng thấp

Ngày tải lên: 22/07/2014, 00:20

21 358 0
báo cáo khoa học: " A matched-pair cluster design study protocol to evaluate implementation of the Canadian C-spine rule in hospital emergency departments: Phase III" ppt

báo cáo khoa học: " A matched-pair cluster design study protocol to evaluate implementation of the Canadian C-spine rule in hospital emergency departments: Phase III" ppt

... the efficiency of patient care can be improved Secondary objectives are to determine the sustainability of the intervention, to further evaluate the accuracy of the rule, and to conduct an economic ... Community Matched Pairing 2T 2T 2T 2C 2C 2C Randomization Control Sites TC TC TI TC TI CC CC TI CI CC CI CI Intervention Sites Figure Matched-Pair Design Allocation Scheme for "After" Period Matched-Pair ... http://www.implementationscience.com/content/2/1/4 Objectives The principal objectives of phase II (1999–2002) were to prospectively assess the accuracy, reliability, and clinical sensibility of the Canadian C- Spine Rule and the United...

Ngày tải lên: 11/08/2014, 05:22

14 218 0
Radioactive waste in the Barents and Kara Seas - Russian implementation of the global dumping regime

Radioactive waste in the Barents and Kara Seas - Russian implementation of the global dumping regime

... restrictions on access to bureaucratic decision-making The Chernobyl accident the following year had channelled much of the public disapproval into the environmental area, in particular of activities ... Assessment (OTA), Nuclear Wastes in the Arctic: An Analysis of Arctic and Other Regional Impacts from Soviet Nuclear Contamination (Washington, DC: Office of Technology Assessment, Congress of the United ... region,14 but also because of a tendency to allocate scarce docking facilities to the reloading of operative vessels rather than the unloading of laid-up ones Hence, the backbone of radioactive waste...

Ngày tải lên: 01/11/2013, 09:20

21 489 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf

Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf

... guidelines with the goal of achieving best practices that reduce variation and enhance quality of medical care The Quality Management Directorate of the Army Medical Command (MEDCOM) contracted with ... takes into account the strength of relevant scientific evidence, which is documented in the practice guideline report The guidelines identify specific practices that are either strongly recommended ... resources that aid the MTFs as they carry out actions to improve clinical practices Such support encourages MTFs to make needed practice changes to move toward consistency in practices across...

Ngày tải lên: 17/02/2014, 22:20

212 446 0
Tài liệu Implementation of the Diabetes Practice Guideline in the Army Medical Department - Final Evaluation ppt

Tài liệu Implementation of the Diabetes Practice Guideline in the Army Medical Department - Final Evaluation ppt

... included: • Implementation process evaluation—documented the implementation activities of participating MTFs, described their suc- Introduction cesses in changing clinical practices, identified successes ... Adoption of a practice guideline based on these measures predicts a number of changes in clinical practice (Table 1.2) Table 1.2 Changes in Clinical Practices Predicted by Practice Guideline Implementation ... clearly change the degree of compliance with practitioner-controlled criteria (such as choice of antibiotic), determining the dominant influence on practice is difficult (Evans et al., 1998) Basic Implementation...

Ngày tải lên: 17/02/2014, 22:20

182 355 0
Tài liệu AUDIT OF THE DEPARTMENT OF JUSTICE’S IMPLEMENTATION OF THE INTEGRATED WIRELESS NETWORK ppt

Tài liệu AUDIT OF THE DEPARTMENT OF JUSTICE’S IMPLEMENTATION OF THE INTEGRATED WIRELESS NETWORK ppt

... public version of the report i Office of the Inspector General Audit Approach The Office of the Inspector General (OIG) performed this audit to assess the status of the implementation of the IWN ... wireless communications and centrally manage the consolidated wireless account, known as the Law Enforcement Wireless Communications (LEWC) account The LEWC account supports the maintenance, consolidation, ... determined that the classification of costs did not accurately capture total IWN expenditures According to WMO officials, they have changed the classification categories to improve the way they capture...

Ngày tải lên: 18/02/2014, 04:20

75 384 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

... eukaryotic c class cytochromes [27]; anions exert a strong influence on the lysine residues of cytochrome c, and significantly affect the structure and the functional properties of the protein, as the conserved ... modulates the structure of the A state of cytochrome c Biochemistry 39, 12632– 12638 18 Sinibaldi F, Howes BD, Smulevich G, Ciaccio C, Coletta M & Santucci R (2003) Anion concentration modulates conformation ... Fig Fig Absorbance at 695 nm of acid-denatured cytochrome c in the presence of increasing sulfate (s) and selenate (d) concentrations The optical absorbance of native cytochrome c (—) at pH 7.0...

Ngày tải lên: 19/02/2014, 05:20

11 487 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

... and (c) inactivation of EIIGlc is accelerated in the presence of Glc (see below) Although the dominant reactivity of Cys421 compromised the labelling of other active-site residues, the glucose ... II-BGlc, a glucose receptor of the bacterial phosphotransferase system: molecular cloning of ptsG and purification of the receptor from an overproducing strain of Escherichia coli Proc Natl Acad Sci ... biphasic to a monophasic shape are Table Rates of inactivation of IICBGlc Incubation of purified IICBGlc with the indicated concentration (mM) of the analogues 1a)3d was carried out at 30 C Rate constants...

Ngày tải lên: 21/02/2014, 01:21

12 723 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... amplified from the cDNA #911 using the following pair of primers: 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned ... following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢ EcoRI–BamHI digested PCR product was cloned as a fusion with the GAL4 activation ... using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase expressing construct, a 173-bp PCR fragment of the...

Ngày tải lên: 21/02/2014, 15:20

10 466 0
Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc

Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc

... responses to the DESD The most crucial element to the Decade’s success is the scope of the human resources brought together, including these enthusiastic volunteers and others who have much to offer, ... to an education was reinforced by the Convention on the Right of the Child (CRC) in 1989, which declares that primary education should be compulsory and available free to all The CRC further states ... perspective, another may be concerned with sustainable economic growth and yet another with sociocultural perspectives The added value of the Decade is that it recognizes that these perspectives...

Ngày tải lên: 21/02/2014, 17:20

27 633 0
w