mp4 a human hemoglobin modified with maleimide polyethylene glycol

Study protocol: A randomised, controlled trial of the effectiveness of a physiotherapist-led modified sport intervention for ambulant school-aged children with cerebral palsy

Study protocol: A randomised, controlled trial of the effectiveness of a physiotherapist-led modified sport intervention for ambulant school-aged children with cerebral palsy

... physical education and is included in Australia’s national talent identification and development program [39] Activity and Participation outcomes Individual activity and participation based goals: ... The seated throw measures functional upper limb strength Children are seated comfortably with their back against a wall Using a chest pass, they are asked to throw a basket-ball as far as possible ... descriptive statistics for each variable (individual sports related activity and participation goals, GM capacity, aerobic fitness, anaer-obic fitness and agility, functional strength, participation and

Ngày tải lên: 01/02/2020, 03:56

10 35 0
A voltammetric epithelial sodium channels immunosensor using screen-printed carbon electrode modified with reduced graphene oxide

A voltammetric epithelial sodium channels immunosensor using screen-printed carbon electrode modified with reduced graphene oxide

... reduced graphene oxide Yeni Wahyuni Hartati a* , Sonya Fatimah Yusup a , Fitrilawati b , Santhy Wyantuti a , Yulia Sofiatin c and a Department of Chemistry, Faculty of Mathematics and Natural Sciences, ... Universitas Padjadjaran Bandung, Indonesia b Department of Physics, Faculty of Mathematics and Natural Sciences, Universitas Padjadjaran Bandung, Indonesia c Department of Public Health, Faculty ... active surface area for the immobilization of anti-ENaC Fig 5 C reveals that a particulate appears with several aggregates above the surface of the RGO, indicating that anti-ENaC was successfully

Ngày tải lên: 27/05/2020, 04:20

10 23 0
Phase I clinical trial of a novel autologous modified-DC vaccine in patients with resected NSCLC

Phase I clinical trial of a novel autologous modified-DC vaccine in patients with resected NSCLC

... meta-static castration resistant prostate cancer [12] Since then, several DC vaccine clinical trials in patients with malignant glioma [13], metastatic melanoma [14] ad-vanced hepatocellular carcinoma ... cytoplasm, and MUC1 was mainly expressed in the membrane a Patient 9 with squamous cell carcinoma b Patient 1 with adenocarcinoma Scale bar: 20 μm Trang 7clinical trial of the vaccine in patients with ... markers CEA, SCC, CYFRA21, and CA125 were analysed in all the pa-tients.13 patients had normal tumor markers at baseline, and only 2 patients had abnormal tumor markers The carcino-embryonic antigen

Ngày tải lên: 23/07/2020, 02:59

13 15 0
comparative metabolism of benzo a pyrene by human keratinocytes infected with high risk human papillomavirus types 16 and 18 as episomal or integrated genomes

comparative metabolism of benzo a pyrene by human keratinocytes infected with high risk human papillomavirus types 16 and 18 as episomal or integrated genomes

... standards (b) uninfected primary human foreskin keratinocytes (c) human vaginal keratinocytes infected with episomal human papillomavirus (HPV-16) (d) human cervical keratinocytes infected with ... reagent (Amersham Life Science) according to the manufacturer’s instructions Actin was analyzed using an 8% SDS-polyacrylamide gel and a primary antibody at 1:10000 dilution (Santa-Cruz) The bands ... Trang 1Journal of CarcinogenesisOriginal Article Comparative metabolism of benzo[a]pyrene by human keratinocytes infected with high-risk human papillomavirus types 16 and 18 as episomal or

Ngày tải lên: 01/11/2022, 09:06

10 5 0
motion control for a walking companion robot with a novel human robot interface

motion control for a walking companion robot with a novel human robot interface

... user state Taghvaei et al used a depth sensor to estimate the human state.20,21 Based on the types of human–robot interface, the control algorithms are used accordingly Many available control algorithms ... Trang 1Motion control for a walkingcompanion robot with a novel human–robot interface Yunqi Lv1, Xueshan Gao1, Fuquan Dai1, Yubai Liu1, Abstract A walking companion robot is presented for rehabilitation ... F(N) must be handled first Force value F is calculated from sampled Analog/Digital converter (A/D) voltage data, that is, VAD¼ kliner F Because there are unavoidable deviations in one-axis force

Ngày tải lên: 04/12/2022, 15:34

15 3 0
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

... Higashimita, Tama-ku, Kawasaki, Kanagawa, 214-8571, Japan ** Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562, Nanatsuka, Shobara, Hiroshima 727-0023, Japan ... 2646-2649 Japan Water Works Association (JWWA) (2001) The method of Japan Water Works Association p.573-613 (in Japanese) Kobayashi, F., Hayata, Y., Kohara, K., Muto, N., Miyake, M and Osajima, Y (2006) ... Trang 1Inactivation of microorganisms in untreated water by a Fumiyuki KOBAYASHI*, Futoshi YAZAMA**, Hiromi IKEURA*, Yasuyoshi HAYATA* Norio MUTO** and Yutaka OSAJIMA*** * School of Agriculture,

Ngày tải lên: 05/09/2013, 09:38

10 451 1
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

... Energy and Environment, Rajiv Gandhi Proudyogiki Vishwavidyalaya, Bhopal, India Abstract An experimental investigation has been carried out to examine the Performance parameters and exhaust emission ... is an alternative, renewable, clean diesel fuel made by conversion of the vegetable oils, waste animal fats to esters via transesterification with methanol or ethanol using catalyst The reaction ... agriculture practices One hectare of plantation on average soil will give 1.6 MT oil [21] There are several advantages with Jatropha Firstly, it is easier to harvest than large tree and has much shorter

Ngày tải lên: 05/09/2013, 16:11

12 571 0
Tài liệu CREATE A TOTAL ASSEMBLY DRAWING WITH BOM AS A NOTE docx

Tài liệu CREATE A TOTAL ASSEMBLY DRAWING WITH BOM AS A NOTE docx

... the Repeat Region Repeat Regions automatically add text and expand downward as the model changes Trang 17Select a cell in the third row you want to designate as a repeat region From the TABLE pull ... Repeat the same procedure as shown above to add the next sheet, and create the assembly drawing of pin link as shown below Trang 25CREATE A DRAWING FOR PIN LINK PLATE Create a detailed drawing ... location Save the drawing Trang 1010Trang 11CREATE A DRAWING FOR ROLLER LINK WITH BOM The Sheets command in the DRAWING menu can be used to create multiple sheets drawings To Add a new drawing

Ngày tải lên: 22/12/2013, 11:17

25 361 1
Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

... USA) SDS was purchased from GE Healthcare (Central Plaza, Singapore) Ammonium persulfate and N,N,N¢,N¢-tetramethylenediamine were purchased from Amersham Pharmacia (Piscataway, NJ, USA) EDTA was ... appropriate primary antibody SLC25A4 mAb, Abnova, Taipei, Taiwan; HLA Class 1 A1 antibody, Abcam; Tapasin antibody, Abcam) at a dilution of 1 : 1000 for 2 h, followed by incubation for 1 h with ... HLA-A1, HLA class I histocompatibility antigen A-1; iTRAQ, isobaric tags with related and absolute quantitation; SLC25A4, mitochondrial solute carrier family 25A4; TAPBP, tapasin. Trang 2matous polyps

Ngày tải lên: 16/02/2014, 15:20

11 590 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

... drought- and ABA-regulated gene expression Plant Mol Biol 24, 701–713 15 Prabakaran P, An J, Gromiha M, Selvaraj S, Uedaira H, Kono H & Sarai A (2001) Thermodynamic database for protein-nucleic acid ... were aligned computationally and the appearance of a base at each position in a motif was presented as a percentage fre-quency of all four kinds of base The base with a frefre-quency higher than ... 1 Okamuro JK, Caster B, Villarroel R, Van Montagu M & Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis Proc Natl Acad Sci USA 94,

Ngày tải lên: 18/02/2014, 13:20

10 464 1
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... Kawamukai, Faculty of Life and Environmental Science, Shimane University, 1060 Nishikawatsu, Matsue 690-8504, Japan Fax: +81 852 32 6092 Tel: +81 852 32 6587 E-mail: kawamuka@life.shimane-u.ac.jp ... Trang 1Comparison of a coq7 deletion mutant with otherrespiration-defective mutants in fission yeast Risa Miki, Ryoichi Saiki, Yoshihisa Ozoe and Makoto Kawamukai Department of Applied ... ubiquinone-6, E coli has ubiquinone-8, rats and Arabidopsis thaliana have ubiquinone-9, and humans and Schizosacchar-omyces pombe have ubiquinone-10 [8–10] The length of the side chain is determined

Ngày tải lên: 18/02/2014, 14:20

16 647 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢ AG-3¢) that had 5¢ adapters corresponding to BamHI (GGATCC) and XhoI (CTCGAG) ... 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ ... invertebrates, and has three crystal phases: calcite, ara-gonite and vaterite Although calcite is the most stable crystal thermodynamically, many organisms can form metastable aragonite crystals with

Ngày tải lên: 18/02/2014, 17:20

12 577 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface area of  81 000 A˚2 with 30% ( 24 000 A˚2) as con-tact area Thus, a large amount ... complementary oligomers 5ằ-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3ằ (forward) and 5ằ-CGGTTTTAACGCGATAAAAT TATCGCCCCTCCCGCC-3ằ (reverse) Virus amplification was performed in monolayer SF21 cells, and ... 5ằ-TCCGAAACCAGCGGCCGCTT TATCGCGTTAAAACCGGTGATCAAACCCC-3ằ and the reverse oligomer 5ằ-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3ằ were used to introduce a Not1 site followed by the hAd12pb hypervariable

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Forecasting UK GDP growth, inflation and interest rates under structural change: a comparison of models with time-varying parameters potx

Forecasting UK GDP growth, inflation and interest rates under structural change: a comparison of models with time-varying parameters potx

... forecasting In particular, models that incorporate a gradual change in parameters and also include a large set of explanatory variables do particularly well as far as the inflation forecast is concerned ... lead to large and statistically significant gains in forecast accuracy Key words: Time-varying parameters, stochastic volatility, VAR, FAVAR, forecasting, Bayesian estimation JEL classification: ... External MPC Unit Bank of England Email: alina.barnett@bankofengland.co.uk (2) Centre for Central Banking Studies Bank of England Email: haroon.mumtaz@bankofengland.co.uk (3) Monetary Assessment and

Ngày tải lên: 06/03/2014, 14:20

56 474 1
Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

... and antisense primer sequences were 5¢-TGTGAGT CCATTAATCGATGAAACC-3¢ and 5¢-ACCTGATCG CTTGGCATCTG-3¢, respectively The probe sequence was as follows: (FAM)-AGCTGATGCTATTCAAACTCGA ACGCCTCT-(TAMRA) ... The day after seeding, cells were transfected with 10 nm pan-PDE1C siRNA smart pool (Ambion Inc., Austin, TX, USA) [pool number M-007643– 00, sequences CCAAGGAGATTGAAGAATT (1), GAT CATGCACTGAAATTTA ... increase in intracellular Ca2+ concentrations (the mean values and standard deviations of three experiments are shown) (C) As measured by lactate dehydrogenase assays, treatment of A172 cells with

Ngày tải lên: 07/03/2014, 05:20

13 465 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

... Trang 1Annals of Mathematics On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri Trang 2On the Julia set of a typicalquadratic polynomial with ... is as follows: When a nb n , we say that a n /b nis boundedfrom above by a constant which is asymptotically universal Similarly, when a n b n , we say that a n and b n are comparable up to a ... Beltramidifferentials with unbounded dilatation [Da] David’s integrability condition requires that for all large K, the area of the set of points where the dilatation is greater than K be dominated by an exponentially

Ngày tải lên: 14/03/2014, 22:20

53 384 0
Consultative document A framework for dealing with domestic systemically important banks pptx

Consultative document A framework for dealing with domestic systemically important banks pptx

... from Argentina, Australia, Belgium, Brazil, Canada, China, France, Germany, Hong Kong SAR, India, Indonesia, Italy, Japan, Korea, Luxembourg, Mexico, the Netherlands, Russia, Saudi Arabia, Singapore, ... the failure of a globally active bank As such this allowed for an assessment of the banks that are systemically important in a global context The unit of analysis was naturally set at the globally ... states that “global systemic importance should be measured in terms of the impact that a failure of a bank can have on the global financial system and wider economy rather than the risk that a

Ngày tải lên: 15/03/2014, 10:20

16 433 0
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx

Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx

... I-related receptor consisting of a heavy chain (HC) with three ectodomains (a1 , a2 and a3 ), a transmembrane part and a short intracellular signaling tail Like MHC class I HC, the FcRn counterpart ... Sundaresan G, Subbarayan M, Carter NH, Ikle DN, Yazaki PJ, Chatziioannou AF, Gambhir SS et al (2005) Tailoring the pharmacokinetics and positron emission tomography imaging properties of anti-carcinoembryonic ... The Authors Journal compilation ª 2008 FEBS 4103 A B A4 05 J T Andersen et al A4 05 FcRn HC mutant D A 405 C Fig Immunization, purification and evaluation of anti-FcRn antibody preparations Goat...

Ngày tải lên: 16/03/2014, 06:20

14 535 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... DAnorm ¼ aa Á expðÀka Á ½O2 Š Á tÞ þ ab ÁexpðÀkb Á ½O2 ŠÁtÞ ð2Þ where DAnorm is a normalized change in optical density of the sample and aa, ab, k a and k¢b are the amplitudes and rate constants ... R, Khan I, Juczszak L, Wang J, Manjula B, Acharya SA, Bonaventura C & Friedman JM (2004) Domain-specific effector interactions within the central cavity of human adult hemoglobin in solution and ... The authors thank Anna V Chistyakova and Dr Nona V Konovalova for preparing protein solutions This work was supported by the Belarusian Republican Foundation for Fundamental Research (Grant B00-176)...

Ngày tải lên: 16/03/2014, 14:20

11 578 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains...

Ngày tải lên: 23/03/2014, 07:20

11 428 0
w