... Trang 1Equation, Institute of Mathematicsand Mechanics-Azerbaijan National Academy of Science, 9, F Agayev Street, Baku AZ1141, Azerbaijan Full list of author information is available at the ... the asymptotic of the eigenvaluedistribution and regularized trace of the considered problem will be studied It is clear that because of the appearance of an eigenvalue parameter in the boundary ... boundary condition at 1 involves both the eigenvalue parameter l and physical parameter h <0 Problems with l-dependent boundary conditions arise upon separation of variables in the heat and wave
Ngày tải lên: 21/06/2014, 02:20
... (Tabs II and III) and therefore the raw 10-week body mass data were transformed to have a mean of 0 and a standard deviation of 1 within each sex and population (i.e., by subtracting the mean and ... potential problem in this type of analysis [9] We therefore tested for epistasis using the raw data as well as data standardised to have a mean of 0 and a standard deviation of 1 within each sex and ... body mass data were first transformed to have a mean of 0 and a standard deviation of 1 within each sex and population; the resulting estimates are therefore in phenotypic standard deviation
Ngày tải lên: 14/08/2014, 13:22
influence of dust and mud on the optical chemical and mechanical properties of a pv protective glass
... glass, dust, dry mud, and glass surface after mud removal. Trang 7small particles The alkali and alkaline earth metals (Na and Ca) in the particles dissolve in the water during the mud formation, ... Trang 1Influence of dust and mud on the optical, chemical, and mechanical properties of a pv protective glass Bekir Sami Yilbas 1 , Haider Ali 1 , Mazen M Khaled 2 , Nasser Al-Aqeeli 1 , Numan ... Sahara Desert was investigated by Middleton5 The data showed that dust-storm activity in the west and east of the Sudano–Sahelian belt had dramatically increased during the drought years; by a
Ngày tải lên: 04/12/2022, 14:53
Development and performance evaluation of a novel dynamic headspace vacuum transfer “In Trap” extraction method for volatile compounds and comparison with headspace solid-phase
... constructedmatrix(ACM).Weassessthemethod’ssensitivity,and itssuitabilityforthequalitativeandquantitativeanalysisofabroad rangeofvolatilecompounds,smallsamplevolume,andlarge sam-pleseries.ThesuitabilityandefficiencyofDHS-VTTwereverified ... Theextractionratio(E)ofthemethodwasevaluatedbyextracting thesamesamplefivetimes.TheEvaluewascalculatedaccording toZimmermannetal.,byplottingthelogarithmicalpeakareas againstthenumberofextractionandasimplifiedEq.(2)[30] ... timesandrequirementsforlargesamplequantity.Thisstudyreportsonthedevelopmentand appli-cationofanewextractiontechniquebasedonHS-ITEXhardware,whichimprovestheextractionrate andcapacitybyoperatingunderreducedpressure,calledDynamicHeadspaceVacuumTransferIn-Trap Extraction(DHS-VTT).TheresultsofthestudyindicatethatDHS-VTTimprovestheextractionofthe
Ngày tải lên: 25/12/2022, 00:42
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine
... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... unsaturation By observing Table 3 and Table 5, the above statement can be justified Biodiesel of palm has a lower percentage of unsaturation, but still has a longer ignition delay as compared ... heating value and the mass fraction burnt for a given crank angle duration • Sauter mean diameter (SMD) has shown to increase with increasing surface tension (and hence density) and with increasing
Ngày tải lên: 05/09/2013, 15:28
Different physical and chemical pretreatments of wheat straw for enhanced biobutanol production in simultaneous saccharification and fermentation
... pretreatments are acidic, alkaline, and water pretreatment Sulfuric acid and monoethanolamine (MEA) are applied as catalysts during acid and alkaline pretreatment No catalysts are applied during water ... Comparison of sugar concentrations during saccharificaiton with alkaline pretreatment at different concentrations of monoethanolamine: at 3.3% biomass, pretreatment at 135°C, and saccharification ... water in a 200 ml shaker flask The biomass concentration of 2.5, 3.3, 4.0, and 7.0% were examined by adding 2.5, 3.3, 4.0, and 7.0 g of wheat straw to each shaker flask Then each flask was autoclaved
Ngày tải lên: 05/09/2013, 15:28
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... Environment, Rajiv Gandhi Proudyogiki Vishwavidyalaya, Bhopal, India Abstract An experimental investigation has been carried out to examine the Performance parameters and exhaust emission of a diesel ... hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies [22] Trang 3International Journal of Energy and
Ngày tải lên: 05/09/2013, 16:11
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil
... southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran oil is extracted ... Craig WK, Zoerb GC Engine deposit and pour point studies using canola oil as a Diesel fuel ASAE, 49085, 1982, p 349 [12] Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics ... preheated rice bran oil R Raghu1, G Ramadoss2 1 Department of Mechanical Engineering, Jayam College of Engineering and Technology, Dharmapuri, Tamil Nadu, India 2 Department of Mechanical Engineering,
Ngày tải lên: 05/09/2013, 16:11
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... http://www.cubic.bioc.columbia.edu/predictprotein) RNA extraction and quantitative real-time RT-PCR Total RNA was extracted from human tissues and human primary cells using Qiagen RNA purification kit (Qiagen, Valencia, CA) and used in real-time ... regulators of apoptosis [12,13] Caspases are rou-tinely used as a measure of apoptosis, in contrast to necrosis Caspase 3 activation occurs at the intersec-tion of all caspase-dependent pathways and ... ANKHD1 vari-ant 2 In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S are comprised
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx
... prepare a DmEH probe, primers (5¢-ATGGCGAAC ATCTGGCCACGAATC-3¢ and 5¢-TTATGAGAAATT GGCTTTCTGGAC-3¢) were used, and to prepare Actin 5C probe as an internal marker, primers (5¢-GTTCGA GACCTTCAACTCGC-3¢ ... poly(A)-RNA was extracted from the larvae, and 300 ng mRNA of each sample was loaded on a gel Actin mRNA served as an internal marker to equate mRNA quantities. Fig 9 Alignment of deduced amino acid ... contained a SalI site (5¢-CTACGTCGACGATGGCGAA CATCTGGCCACGAATC-3¢); the reverse primer corres-ponded to the 3¢-end of the ORF and contained an XbaI site (5¢-AGGCTCTAGATTTATGAGAAATTGGCTTTCTG GAC-3¢)
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... that Ca chemical shifts are sensitive to solvent variation, causing an under-estimation of calculated CSDs These CSDHaand CSDCa variations demonstrate the formation of more stable and abundant ... same Ala substitution was reported to cause a significant decrease in biological activities of [Ala8]NKA measured in human tissues [44] Indeed, [Ala8]NKA(4–10) was shown to be a weak partial agonist ... peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit pulmonary artery and rat portal vein, two NK-2 receptor bioassays
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... Harduin-Lepers, unpublished data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back and subcloned into pUC19 ... thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland Almost no expression was observed in fetal lung and heart, uterus, bladder, kidney, ... bp fragment was obtained after the annealing of the two following synthetic oligonucleotides For EGT 5¢-GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... temperature After washing, 100 lL of a 1.35-mMphosphatase substrate (SIGMA 104, Sigma-Aldrich, Bornem, Belgium) solution was added and the absorbance was measured after 30 and 60 min at 405 ... control surface Data were analyzed according to a 1 : 1 Langmuir Binding model (v2¼ 0.769), a two-state reaction model assuming a conformational change (v2¼ 0.548) and a bivalent analyte (v2¼ ... during an association time of 180 s and a dissociation time of 120 s at a constant flow rate of 20 lLÆmin)1at 25C The signal of the control canal with the irrelevant peptide was subtracted from
Ngày tải lên: 08/03/2014, 08:20
Concentration and chemical speciations of cu, zn, pb and cr of urban soils in nanjing, china
... China and the natural background value of soils in the Nanjing area Taking the natural background values + standard deviation as an evaluation criteria (Lu, 1999), 31.9%, 41.3% and 16.7% of urban ... Group of Natural Background Values of Soil and Academia Sinica (1979) Liu (1996) concentration is triple the mean value of soils in China and twice as much as the natural background value of soils ... the Nanjing area The mean total Zn concentration is greater than the mean value of soils in China and twice as much as the natural background value of soils in the Nanjing area The mean total Pb
Ngày tải lên: 15/03/2014, 23:22
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... GVTGGGASVSTT SATQGSG, GFSEGTAAISQTAGANGGATV, and Fig 1 Mrcp-19k from M rosa cement and its bacterial recombi-nant analyzed by SDS ⁄ PAGE Lanes 1 and 2: GSF1 and GSF2 pre-pared from M rosa cement, ... (supplementary Fig S1A) The molecular masses and isoelectric points of the mature Table 1 Predicted and observed molecular masses and predicted isoelectric points of cp-19ks Calculated mass (Mass cDNA ... Balcp-19k, and Bicp-19k M rosa, B improvisus and B albicostatus were collected from Miyako Bay (Iwate), Yodo River (Osaka) and Shi-mizu Bay (Shizuoka, Japan), respectively RNA and DNA manipulation was
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... isolated DNA was extracted with phenol and chloroform, precipitated with ethanol and Na-acetate, and resuspended into water Total cellular DNA was also alternatively isolated with QIAamp DNA Blood ... numbering accord-ingly), and found to be 3748 nucleotides in length A TATA-box (TATAA) was located at nucleotides 83–87 and a poly(A) sequence ATTAAA at nucleotides 2978–2983 A GC-rich area was 107 ... 3177–3182 4 Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
... human FcRn The structural and func-tional integrity was proved by CD, surface plasmon resonance and MALDI-TOF peptide mapping analyses The strategy may generally be translated to the large-scale ... half-life of IgG and albumin [1–3], is a major histocompatibility complex (MHC) class I-related receptor consisting of a heavy chain (HC) with three ectodomains (a1, a2 and a3), a transmembrane ... 251 and 252 The ion at m ⁄ z 2332.06 (Fig 4C) was selected for fragmentation, and observed y-, b- and a-fragment ions are indicated For an easier illustration observed y- and b-fragment ions are
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot
... protein and ligand, van der Waals energy between the protein and ligand and within the ligand, and internal torsion energy for the ligand To consider Fig 2 Summary of sequential and medium-range ... restraints Fifty conformations that give low conformation energy and that give no distance and dihedral angle violations greater than 0.5 A˚ and 5 A˚, respectively, were obtained Statistical data ... Trang 1of a gibberellin mimic peptide as a peptidyl mimotopefor a hydrophobic ligand Takashi Murata1,3, Hikaru Hemmi1, Shugo Nakamura2, Kentaro Shimizu2, Yoshihito Suzuki3and Isomaro Yamaguchi3
Ngày tải lên: 16/03/2014, 23:20
Báo cáo Y học: Purification, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx
... Trang 1Purification, crystallization, NMR spectroscopy and biochemicalanalyses of a-phycoerythrocyanin peptides Georg Wiegand1, Axel Parbel2*, Markus H J Seifert1, Tad A Holak1and Wolfgang ... on light quality N-Terminal amino acid analyses and mass spectrometry characterized a series of a-PEC peptides which occurred during storage in formic acid The Z- and E-configurations of one chromopeptide ... (Millipore,USA) [22] The peptides were con-centrated by ultrafiltration and the photoactivity was tested by absorbance spectra after alternative irradiation with the two light qualities Mass spectrometry and
Ngày tải lên: 17/03/2014, 10:20
Tài liệu PHYSICAL AND CHEMICAL ASPECTS OF ORGANIC ELECTRONIC doc
... Chemistry Technical University of Dresden 01062 Dresden Germany Ralf Anselmann Evonik Industries Creavis Technology and Innovation Paul-Baumann-Straße 1 45764 Marl Germany Kannan Balasubramanian Max-Planck-Institute ... the ad- vantage that the deposition of the molecular material on a substrate is much more straightforward. Polymers at that stage are typically liquid and have – of course – a very low vapour ... Processability of Organic Compounds for Applications in Organic Electronics In general, for the realisation of OFETs two classes of materials are available: polymers and small molecules (so-called...
Ngày tải lên: 16/02/2014, 19:20