master slave control loops if a proces

... pair cable and standard connectors A few European PLC manufacturers immediately adopted this standard This Bit Bus, however, was also seen to have a major shortfall, in that it was based on a ... as if either user fails, no communication can take place anyway In a bus configuration, however, this is not always the case For installations where the 'master' device is always in control and ... COMMUNICATIONS IN A PROCESS CONTROL SYSTEM by GR MacKenzie, AEG Communication has become a major part of any process control automation system Today PLC communication is as much for data acquisition...

Ngày tải lên: 25/12/2013, 08:50

... produce large forces at a distant location and in any orientation [14], and a slave cylinder can have a much larger power/weight ratio than a motor placed at the slave Cables present a promising ... the master and slave side and collect position and velocity data of the master and slave side as well as the torque output on the slave side This data were used to analyze the system and compare ... modification and integration of additional hardware • allows easy transfer of data for post-processing • can communicate with other devices to generate visual and auditive feedback and send and...

Ngày tải lên: 03/10/2015, 21:57

... Surrogate data refers to random data that are generated in such a way that they have the same mean, variance and auto-correlation as the original data This basically means that for both original and ... 2005 R Ramachandran, S Lakshminarayanan and G.P Rangaiah, “Investigating Chaos in an Industrial Fluid Catalytic Cracking Unit”, Presented at the American Control Conference, Portland, USA, June ... There are practical situations where it is imperative to be able to distinguish between a linear Gaussian process, a linear non-Gaussian process and a nonlinear non-Gaussian process A linear Gaussian...

Ngày tải lên: 28/11/2015, 13:34

... study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analysis by socioeconomic status In conclusion, the basic principles of equivalence are also ... epidemiological survey data The sex-matched living spouse control design as an alternative control selection for a nationwide population-based case -control study is valid and feasible, and can produce ... given indication Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers The possible explanations may be:...

Ngày tải lên: 26/10/2012, 09:48

... Alkylphenol-ethoxylates (APE), Ethinylestradiol (EE2) using Enzyme-Linked Immunosorbent Assay (ELISA, TAKEDA, JAPAN) kit applied by the antigen-antibody reaction was analyzed Seoul Andong Daegu Busan Andong Waegwan ... mainstream, points in branch streams, water treatment plants, and sewage treatment plants one each from the upstream of Andong area to downstream of Busan area of Nakdong river basin Estrogenic activity ... Water treatment plants The removal of estrogenic substances by conventional and advanced activated sludge treatment was estimated Advanced purifying processes including ozonation and Granular...

Ngày tải lên: 05/09/2013, 08:40

... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets ... 1972 Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with ... Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C., Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach for the improvement...

Ngày tải lên: 05/09/2013, 16:30

... Preview dialog box Next, you need to create a DataSet object You use a DataSet object to a store local copy of the information stored in the database A DataSet object can represent database structures ... your database administrator) Drill down to the Customers table in the Northwind database and drag it to your form This creates a SqlConnection object named sqlConnection1 and a SqlDataAdapter ... contains DataSet1, as shown in Figure 6.15 Figure 6.15: Entering the DataSet details in the Generate Dataset dialog box Click the OK button to continue This adds a new DataSet object named dataSet11...

Ngày tải lên: 07/11/2013, 10:15

... trình Assembler Thiết kế giao diện với máy tính: dùng ngôn ngữ lập trình VisualBasic 4.Khả ứng dụng đề tài Hệ thống đợc ứng dụng nhiều lĩnh vực khác nh: điều khiển thiết bị điện gia đình, quan hay ... qua khối giao tiếp RS 232, vi điều khiển nhận lệnh máy tính gửi đến tiến hành giải mã lệnh Lệnh bao gồm byte header, byte ID để xác định vi điều khiển thực lệnh, byte lệnh sau byte kết thúc Sau ... nghiên cứu khoa học HS-SV Hệ thống có tính sau: Điều khiển việc đánh chuông học tự động cho giảng đờng Điều khiển bật tắt đèn chiếu sáng tự động cho hành lang, cầu thang khu vực quanh giảng đờng...

Ngày tải lên: 09/12/2013, 22:15

... of a catalyst, and at lower temperatures (usually around 315-37O0C [600-70O0F]) than SNCR systems Catalysts are typically titanium- and/or vanadiumbased, and are installed in the flue gas streams ... including cyanuric acid, ammonium sulfate, ammonium carbamate, and hydrazine hydrate A number of proprietary reagents are also offered by several vendors, but all rely on similar chemical reaction processes ... to maintain combustion temperatures and as a start-up fuel 65.5 VOLATILE ORGANIC COMPOUNDS AND ORGANIC HAZARDOUS AIR POLLUTANTS Volatile organic compounds (VOCs) are emitted from a broad variety...

Ngày tải lên: 17/12/2013, 14:15

... is maintained The entire process takes three years A B C D E F G After that we take the olives to an olive press Before pressing the olives we wash them and remove the leaves We spread a large ... market today  False Most of the big sherry companies are Spanish-owned  False The sherry producers want to attract younger markets  True Sherry is produced in several different areas of Spain ... harvest the olives at the end of August A After that we take the olives to an olive press Before pressing the olives we wash them and remove the leaves B We spread a large net or canvas sheet under...

Ngày tải lên: 23/12/2013, 11:15

... but has been given various, somewhat arbitrary, mathematical interpretations, each leading to a separate branch of mainstream control theory and design Although sensitivity is a way of quantifying ... means of several criteria that have to be satisfied simultaneously Finding an appropriate way of representing such criteria mathematically has been a challenge 20 Vladimir Zakian The approach ... Fukushima University Kanayagawa 1, Fukushima, 960-1296 Japan e-mail: ishihara@educ.fukushima-u.ac.jp Paul Geoffrey Lane Federal Agricultural Research Centre (FAL) Institute for Technology and Biosystems...

Ngày tải lên: 01/01/2014, 18:49

Ngày tải lên: 26/01/2014, 07:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk...

Ngày tải lên: 19/02/2014, 17:20

... the attribute values of these layers, are manipulated and analyzed using a map based algebra This set of map based algebraic tools allows determination of co-occurrence at particular locations and ... fine-grained characteristics of the landscape and may vary significantly over distances of a few meters to tens of meters 78 Information availability and scale are closely related Information availability ... values relating to a given variable, such as soil type or depth to groundwater at all x,y locations in the database, are called coverages or data layers, while individual values at particular...

Ngày tải lên: 07/03/2014, 00:20

Ngày tải lên: 08/03/2014, 04:22

... was affable and gay in his manners, and very fond of company An intimate acquaintance was soon formed with Capt Helm and family, and he called almost daily to chat and drink wine with the Captain,—both ... early acquaintances and associates of Mr Steward, while a business man in Rochester in an early day, and take pleasure in bearing testimony to his high personal, moral and Christian character ... read and write, at all hazards, if my life was only spared About this time Capt Helm began to sell off his slaves to different persons, as he could find opportunity, and sometimes at a great sacrifice...

Ngày tải lên: 15/03/2014, 03:20

... the approach taken in [5] and [6] Based on this nonlinear model, we design a path tracking control law based on feedback linearization Feedback linearization designs have the potential of reaching ... systems) A straightforward analysis will show that the system can always be rendered unstable: Just vary the reference input such that transitions are always taken before the transition safe state ... standard approach from here on is to transform the states into normal form via an appropriate dieomorphism followed by feedback linearization of the nonlinearities and a standard linear control...

Ngày tải lên: 22/03/2014, 11:20

Ngày tải lên: 22/03/2014, 23:21