masses is there a role for mammography

Ageing: Is there a role for arachidonic acid and other bioactive lipids? A review

Ageing: Is there a role for arachidonic acid and other bioactive lipids? A review

... body FHAFAs may also form from AA Patients with type diabetes have low plasma levels of FHAFAs, AA and LXA4, which have anti-inflammatory actions This may imply that decreased formation of AA in ... protectins and maresins, which are all potent anti-inflammatory compounds [11,12,23,41–43] For all practical purposes, LA, GLA, DGLA, AA, ALA, EPA, and DHA are all PUFAs, but only LA and ALA are EFAs ... [55] Yagi S, Aihara K, Fukuda D, Takashima A, Bando M, Hara T, et al Reduced ratio of eicosapentaenoic acid and docosahexaenoic acid to arachidonic acid is associated with early onset of acute...

Ngày tải lên: 14/01/2020, 03:27

13 78 0
Is there a role for central bank independence on public debt dynamics?

Is there a role for central bank independence on public debt dynamics?

... al (2015), Hovarth and Vaško (2016), Papadamou et al (2016b) 7See also Papadamou et al (2014) for monetary policy transparency effects on stock market volatility and Papadamou et al (2017) for ... analysis that follows, annual data on the general government debt and deficit as percentages of the GDP are gathered from the OECD database Moreover, the Bank for International Settlement (BIS) ... Canada, New Zealand, Norway, Denmark and Switzerland) In Italy, Belgium, Portugal and Spain there have been gradual changes in the level of independence While in Germany, Nederland, Finland and...

Ngày tải lên: 01/02/2020, 22:34

15 60 0
endoplasmic reticulum stress induced apoptosis in the development of diabetes is there a role for adipose tissue and liver

endoplasmic reticulum stress induced apoptosis in the development of diabetes is there a role for adipose tissue and liver

... degradation (ERAD), and degraded by the pro-teasome As a major intracellular calcium storage com-partment, the ER also plays a critical role towards maintenance of cellular calcium homeostasis In addition, ... pioglitazone treatment and this may play an essential role in the management of diabetes mel-litus and metabolic syndrome [68] Hypoxia and hypoxia related ER stress may also play a role in apoptosis ... Nakatani Y, Kaneto H, Kawamori D, Yoshiuchi K, Hatazaki M, Matsuoka TA, Ozawa K, Ogawa S, Hori M, Yamasaki Y, Matsuhisa M (2005) Involvement of endoplasmic reticulum stress Obesity IR Inflammation...

Ngày tải lên: 02/11/2022, 09:29

11 8 0
is there a future for quantum chemistry

is there a future for quantum chemistry

... Initio Calculations Statistical Mechanics Molecular Dynamics Monte CarloTransition State Theory Trang 5Quantum Chemistry & Transition State TheoryConstruct potential energy surface for a few ... Trang 3Theoretical Chemistrytheoretical reasoning, usually within physics and mathematics i h ˙ψ = H ψ Quantum Mechanics S = k log W Statistical Mechanics Trang 4Computational ChemistryComputational ... of orbital levels important for chargelocalization and for electron injection dynamics Trang 19I− Distribution at InterfaceTrang 20I− Distribution at Interface• Solvent near interface cannot be...

Ngày tải lên: 02/06/2014, 09:45

25 370 0
LOOKING for a FIGHT IS THERE A Republican War on Science? potx

LOOKING for a FIGHT IS THERE A Republican War on Science? potx

... that DDT (a commodity chemical) is a panacea for malaria and as far as I can see none at all in “intelligent design” In-telligent design isn’t even a particularly congenial theory for fundamentalist ... this enon phenom-There is a particular kind of irrationalism Adorno tified, which is characteristic of authoritarian politics (and therefore also, I hardly need to say, of the kind of authoritar-ian ... Machia-vellianism, zealotry, and—in foreign policy matters—hubris That last ingredient may presently be evaporating upon con-tact with reality At any rate, let’s consider Machiavellianism and zealotry...

Ngày tải lên: 22/03/2014, 23:20

100 356 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

... recent data suggest that PAR3 does not mediate signal transduction directly but instead acts as a cofactor for the cleavage and activation of PAR4 [27] Thrombin has been shown to cleave and activate ... hypothesis that duodenase is not acting via a classical PAR2 In summary, this study has demonstrated that duoden-ase induces DNA synthesis in pulmonary artery fibro-blasts and that this response may be ... pathways has a modulatory rather than a mandatory role to play in mediating the proliferative response In contrast, a recent report has shown that tryptase induces DNA synthesis in canine tracheal...

Ngày tải lên: 24/03/2014, 03:21

10 439 0
is there a new vision for maghreb economic integration

is there a new vision for maghreb economic integration

... Comtrade data ASEAN 5= Malaysia, Thailand, Indonesia, Philippines and Singapore SEE= Southern East European countries (Albania, Bosnia and Herzegovina, Bulgaria, Croatia, Macedonia, Romania, Serbia ... Maghreb countries’ revealed comparative advantage and export specialization also reveals that Tunisia’s exports of beverages have a strong comparative advantage in the Maghreb market whereas ... limited and compares unfavorably with other regional blocs. Merchandise trade within the Maghreb (as a share of total merchandise trade) is the lowest among comparator regional trading blocs. In addition,...

Ngày tải lên: 22/05/2014, 12:51

110 2,2K 0
Trade and Poverty Is There a Connection

Trade and Poverty Is There a Connection

... pan-territorial pricing For them, functioning markets have largely disappeared The status quo ante was one of a sole parastatal buyer; the status quo is that often there is no buyer at all or, if there is, ... trade are so poor that transactions occur on a barter basis It is difficult to disentangle the relative importance of institutional and infrastructural factors in this market failure There has ... after five years Rama and MacIsaac (1999) find that employees displaced from the Ecuadorian Central Bank in 1994 had regained on average only 55% of their pre-dismissed salaries after 15 months...

Ngày tải lên: 06/11/2012, 15:51

26 546 0
Is there a duty not to reproduce

Is there a duty not to reproduce

... in which they are aware of the risk that ‘harm’ may arise, but they argue that the disorder is a late-onset disorder, as a consequence not mani-festing itself for many years Again, should they ... further that, ‘This carries the practical advan-tage that the courts can understand and accommodate this form of damage, which allows for a distinction to be made between the serious and slight ... Court of Appeal was unhappy regarding the evaluation of damages How could a court attempt to evaluate non-existence – to compare non-existence and the value of existence in a disabled state? The...

Ngày tải lên: 01/11/2013, 08:20

12 490 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

... + and SG – ⁄ – cells. This was accompanied by the appearance, from about day 12, of May–Gru ¨ nwald ⁄ Giemsa-positive granular structures in SG + ⁄ + cells. A gradual increase in May–Gru ¨ nwald ... stored b-hexosaminidase is influenced by SG. Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after 6 days of culture, and reached ... storage seen after 26 days of culture. mMCP-6 storage showed similar kinetics as for mMCP-5. In contrast, CPA protein was detected as early as after 5 days of culture, and a maximal plat- eau...

Ngày tải lên: 07/03/2014, 11:20

12 441 0
TOWARDS A CARIBBEAN CINEMA - CAN THERE BE OR IS THERE A CARIBBEAN CINEMA? ppt

TOWARDS A CARIBBEAN CINEMA - CAN THERE BE OR IS THERE A CARIBBEAN CINEMA? ppt

... Caribbean sea to include the Caribbean diaspora; places where Caribbean Trang 25people have migrated to and formed a community for example, the east coast of America, Canada and England Stuart ... European languages with the Native American languages and African languages brought by the slaves The result of this mixture is the local patois and Creole languages that are unique to the Caribbean ... traditionally defined as primarily English-speaking nations in the Caribbean Sea namely: Trang 7i the CARICOM (Caribbean Community)states of Antigua-Barbuda, Bahamas, Barbados, Belize, Dominica, Grenada,...

Ngày tải lên: 07/03/2014, 15:20

89 559 0
Context based learning: A role for cinema in science education pdf

Context based learning: A role for cinema in science education pdf

... show in a public performance Whereas a dramatic play is realized as a live performance by actors on a stage, a movie is show in a cinema, not as a live event, and can theoretically be repeated infinitely ... rational use of audiovisual means by misrepresenting their functions and, not taking advantages of the real possibilities (Brake et al, 2003) Trang 5135 An artistic manifestation, as audiovisual ... Trang 1131 Context based learning: A role for cinema in science education Agnaldo Arroio University of São Paulo, Brazil Abstract This paper discusses the role of cinema as a tool for science...

Ngày tải lên: 23/03/2014, 11:21

13 508 0
Loans, Interest Rates and Guarantees: Is There a Link? pdf

Loans, Interest Rates and Guarantees: Is There a Link? pdf

... more risky and, thus, interest rates are higher 3 Data and summary statistics This paper uses aggregated and individual Italian bank and firm data drawn from several sources Aggregated time ... average loan rate would be higher than the rate that is optimal for safe borrowers, and only riskier borrowers would apply for banks loans In these situations collateral and personal guarantees act ... unclear; they are affected by the large share of real-estate loans, which have to be assisted by collateral, according to Italian law As regards producer households, individual data at bank and firm...

Ngày tải lên: 29/03/2014, 01:20

27 402 0
Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx

Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx

... Federal agencies are obligated by the Federal Implementation Plan to perform a comprehensive IS audit at least every 3 years This audit must always examine all aspects of the organisation taking all ... international organisations such as the International Auditing and Assurance Standards Board (IAASB) or the Institute of Internal Auditors (IIA) These publications take IT, as an important component ... responsible for IS audits in the organisation is, among others, to create a rough planning for the IS audit project based on this guide to be substantiated on an annual basis Furthermore, this person is...

Ngày tải lên: 29/03/2014, 22:20

38 507 0
Is there a silver lining? The Indian mutual fund industry pot

Is there a silver lining? The Indian mutual fund industry pot

... Generally, it is more expensive for a distributor to reach out to a retail investor than to a corporate investor While an average retail investor folio has about 35,000 INR of assets, an average ... channel to sell mutual fund products have a relative advantage; this includes AMCs with Indian banks and brokerage houses as sponsors Banks have also been focussing increasingly on earning a ... the range of 15,000 to 17,000, thanks to the prevalent global and local geo-political uncertainties Regardless of all the above factors, the Indian asset management industry has racked up an absolute...

Ngày tải lên: 30/03/2014, 15:20

28 413 0
A Role for the International Criminal Court in the Fight against Terrorism? potx

A Role for the International Criminal Court in the Fight against Terrorism? potx

... example of Trang 14the Taliban and Al Qaeda is very apposite : if Al Qaeda would start to fight the newlyinstalled Afghan government through terrorist attacks on Afghan territory and theAfghan ... same couldprobably be said of the present day political situation in Afghanistan : if the Talibanand Al Qaeda would start to use terrorist attacks on Afghan territory to fight thenewly installed ... terrorist attacks on Afghanterritory and that the Afghan criminal justice system does not bring Taliban and AlQaeda terrorists to justice because it is structurally incapable of doing so : such asituation...

Ngày tải lên: 10/07/2014, 13:21

53 452 1
Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx

Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx

... atypical patients and controls (ANCOVA with age as covariate; significant are p-values below 0.005). Atypical features N = 14 Melancholic features N = 16 A/M ANCOV A A/M Post-hoc A/C ANCOV A A/C ... Fountoulakis KN, Karamouzis M, Iacovides A, Nimatoudis J, Diako-giannis J, Kaprinis G, Demitriadou A, Bech P: Morning and Evening Plasma Melatonin and Dexamethasone Suppression Test in Non-Seasonal ... older (table 2) This is why age was used as covariate a EOG Depressed patients (as a whole), manifested a decrease of both dark trough and light peak values in comparison to controls This did...

Ngày tải lên: 08/08/2014, 21:20

10 485 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... transcriptase (Phar-macia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG ... L, Karin M: Mammalian MAP kinase signalling cascades. Nature 2001, 410:37-40. 14 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated tran-scriptional activation: therapeutic potential in autoimmune ... Cohn L, Ray P, Ray A: A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation Nat Immunol 2001, 2:45-50. 17 Hammaker DR, Boyle DL, Chabaud-Riou...

Ngày tải lên: 09/08/2014, 07:20

10 462 0
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc

Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc

... RA patients There are strong medical and biological arguments in favour of subgrouping RA patients, and an analysis of nonstratified sam-ples might conceal a true association In the initial analysis ... logistic regression analysis for the rs729749 SNP, in order to adjust for age, sex and living area Logistic regression analysis was conducted for a subset of the material, in which all information ... 0.001 was used In order to obtain HWE P values for the case and control groups separately, each dataset was uploaded separately Single marker analysis Contingency tables were created for each SNP...

Ngày tải lên: 09/08/2014, 10:21

11 477 0
w