making a local drawing whiteboard with

... as Diamond Plaza, Parkson Plaza, Jen Plaza, Sai Gon Center, Saigon Paragon, Vincom center…These are places selling many foreign and local brands with diversified and fashionable styles and designs, ... an overview of the data o Exploratory factor analysis (EFA) is applied to the data of official survey Items are analyzed using exploratory factor analysis (EFA) method to determine the actual ... each construct In this step, an accepted method of interpretation of factor loadings is to regard as significant any variable with a loading of 0.5 or greater as associated with the appropriate

Ngày tải lên: 16/05/2017, 20:46

... Trang 1Contents lists available at ScienceDirect Journal of Mathematical Analysis and Applications www.elsevier.com/locate/jmaa On a backward parabolic problem with local Lipschitz ... equations, J Math Anal Appl 47 (1974) 563–572. [19] D.D Trong, P.H Quan, T.V Khanh, N.H Tuan, A nonlinear case of the 1-D backward heat problem: Regularization and error estimate, Z Anal Anwend 26 ... Math Anal Appl 367 (2) (2010) 337–349. [15] L.E Payne, Improperly Posed Problems in Partial Differential Equations, SIAM, Philadelphia, PA, 1975. [16] M Renardy, W.J Hursa, J.A Nohel, Mathematical

Ngày tải lên: 16/12/2017, 15:43

... oncologists and patients with advanced cancer and their caregivers The methods were developed in collaboration with Phyllis Butow, Martin Tattersall, Adam Walczak and colleagues, who are conducting a parallel ... decision making in advanced cancer This article describes an investigation designed to facilitate communication and decision making among oncologists, patients with advanced cancer, and their caregivers ... exclusively care for patients withhematological malignancies Patient ● Currently a patient of an enrolled physician ● Age 21 years or older ● Anticipating bone marrow transplantation or diagnosed with

Ngày tải lên: 05/11/2020, 06:14

... quality, reputable brands, and stylish designs With a plethora of options available from both local and international brands, along with abundant product information accessible through magazines, ... specialty shops like Diamond Plaza, Parkson Plaza, and Vincom Center has significantly enhanced the retail landscape, offering a diverse array of both foreign and local fashion brands These establishments ... total variance Each factor was assigned a distinct name: “product and quality related criteria,” “store and salesperson related criteria,” “style and design related criteria,” “image and brand

Ngày tải lên: 01/09/2023, 22:43

... ofTra Kieu citadel and the My Son temple tower relic area Through manybattles During the war, Champa kingdom was gradually pushed south by DaiViet In 1471, the last capital of Champa at Bau Gia, ... brilliant Sa Huynh culture At migration sites and burial sites such as Hau Xa, Thanh Chiem, An Bang,Xuan Lam, Trang Soi, Dong Na, etc., many types of graves, jars, productiontools, and ornaments ... 3architectural schools: Vietnam, Japan, and China Trang 12Pa dynasty were held. Trang 13Rung dua Bay Mau• Address: Cam Thanh Commune, Hoi An City Seven Mau coconut forest is located about 3 km southeast

Ngày tải lên: 30/01/2024, 05:16

... a landscape On rare occasions they may go so far as to suggest using photographs as a basis for drawing but, aware that this can lead to sterile, lifeless results, mention the practice only as ... parameters that are unnecessarily narrow A human figure is the most expressive single image available to the artist, and the most suitable for meaningful imaginative interpretations We can draw anything ... yet, at the same time, fresh You already the information, but you may never have thought about it rational, analytical fashion human figure is almost invariably one of the first things en attempt

Ngày tải lên: 21/01/2014, 08:20

... finer details, and then finally the pattern, texture and shading 91 Trang 6FIGURE DRAWING WITHOUT A MODEL 92 In the drawing here the image | wanted was of a man wearing araincoat | imagined ... produce huge panoramic views of the campaigns abroad At that time no distinction was drawn between illustration and fine art, and memory drawing was a part of every artist's training Exercises ... use his practice as a paradigm — far from it! To my mind, such unnecessary reliance upon retention and recall of the visual world has great disadvantages, as it must inevitably lead to rather stereotyped

Ngày tải lên: 21/01/2014, 08:20

... ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢ AG-3¢) that had 5¢ adapters corresponding to BamHI (GGATCC) and XhoI (CTCGAG) ... 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ ... invertebrates, and has three crystal phases: calcite, ara-gonite and vaterite Although calcite is the most stable crystal thermodynamically, many organisms can form metastable aragonite crystals with

Ngày tải lên: 18/02/2014, 17:20

... rural areas, generally within large families Many are landless, have very small landholdings and are from specific ethnic minority groups such as low caste (dalit) and indigenous peoples (janajati) ... Collinearity and bivariate analysis The value from Pearson correlation coefficient (r) shows that while many of the covariates are correlated to some degree only age and parity are correlated with a coeffi-cient ... to participate in making major household purchases, daily household pur-chases and visits to her family or relatives compared to all wealth quintiles Multivariate analysis In this analysis age,

Ngày tải lên: 05/03/2014, 15:20

... policymakers in designing reform The data set covers 183 economies: 46 in Sub-Saharan Africa, 32 in Latin America and the Caribbean, 25 in Eastern Europe and Central Asia, 24 in East Asia and Pacific, ... and landscaping projects as well For final approval, these project plans are submitted to the municipal project branch, for static, sanitation facility, heating and heat insulation, and landscaping ... for an announcement in the Commercial Registration Gazette within about 10 days of company registration A tax identification plaque must be obtained from the local tax office after the Commercial

Ngày tải lên: 05/03/2014, 20:20

... Trang 1A local regularity theorem for mean curvature flow By Brian White Trang 2A local regularity theorem for mean curvature flowBy Brian White* AbstractThis paper proves curvature bounds ... Theorem) that for a nonfattening mean curvatureflow in RN, the surface is almost everywhere regular at all but countably manytimes (A slightly weaker partial regularity result was proved using Brakke’sTheorem ... Euclidean space) In Section 5, the analogousestimates at the boundary (or “edge”) are proved for motion of manifolds-with-boundary In Section 6, somewhat weaker estimates (namely C1,α and W2,p) are

Ngày tải lên: 06/03/2014, 08:21

... forecasting In particular, models that incorporate a gradual change in parameters and also include a large set of explanatory variables do particularly well as far as the inflation forecast is concerned ... lead to large and statistically significant gains in forecast accuracy Key words: Time-varying parameters, stochastic volatility, VAR, FAVAR, forecasting, Bayesian estimation JEL classification: ... External MPC Unit Bank of England Email: alina.barnett@bankofengland.co.uk (2) Centre for Central Banking Studies Bank of England Email: haroon.mumtaz@bankofengland.co.uk (3) Monetary Assessment and

Ngày tải lên: 06/03/2014, 14:20

... Trang 1Annals of Mathematics On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri Trang 2On the Julia set of a typicalquadratic polynomial with ... is as follows: When a n
b n , we say that a n /b nis boundedfrom above by a constant which is asymptotically universal Similarly, when a n b n , we say that a n and b n are comparable up to a ... Beltramidifferentials with unbounded dilatation [Da] David’s integrability condition requires that for all large K, the area of the set of points where the dilatation is greater than K be dominated by an exponentially

Ngày tải lên: 14/03/2014, 22:20

... from Argentina, Australia, Belgium, Brazil, Canada, China, France, Germany, Hong Kong SAR, India, Indonesia, Italy, Japan, Korea, Luxembourg, Mexico, the Netherlands, Russia, Saudi Arabia, Singapore, ... the failure of a globally active bank As such this allowed for an assessment of the banks that are systemically important in a global context The unit of analysis was naturally set at the globally ... states that “global systemic importance should be measured in terms of the impact that a failure of a bank can have on the global financial system and wider economy rather than the risk that a

Ngày tải lên: 15/03/2014, 10:20

... Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATAC N77G Forward ... bold. Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT ... recombinant cystatin A variants with Gly replacing each of these amino acids were prepared, and their interaction with papain, cathepsin L, and cathepsin B was characterized by equilibrium and kinetic

Ngày tải lên: 17/03/2014, 10:20

... hypothetical and the last was the actual round A pen and a picture frame were used in the hypothetical situations, and a coffee mug was used for the actual situation Only the actual round had a real payoff, ... A is treated as a mistake Bechara et al conducted their gambling task with a population of healthy adults and a population of individuals with damage to the ventromedial prefrontal cortex (VM) ... Charles R Plottb,3, John M Allmanc,4 aCalifornia Institute of Technology, MSC 323, Pasadena, CA 91125, USA bCalifornia Institute of Technology, MSC 228-77, Pasadena, CA 91125, USA cCalifornia

Ngày tải lên: 22/03/2014, 14:20

... of a HOME PAGE, A CONTACT PAGE, AN AFFILAITE PAGE and a payment button so customers can buy and download your product Paypal offer great easy to use payment buttons that automatically link up with ... your Paypal account Create a Free Viral eBook A great marketing strategy is to create a FREE viral eBook and distribute it to as many people as you can In order for an eBook to be truly viral it ... traffic than seller A The best and most reliable affiliate handler is clickbank.com Clickbank are probably the largest retailer of digital downloadable products on the internet They always pay

Ngày tải lên: 22/03/2014, 20:21

... high income Latin America & Caribbean Sub-Saharan Africa South Asia East Asia & Pacific Middle East & North Africa Eastern Europe & Central Asia 2010 global average DB2006 DB2011 ... and North Africa OECD high income Eastern Europe & Central Asia South Asia East Asia & Pacific Middle East & North Africa Sub-Saharan Africa Latin America & Caribbean OECD high ... income per capita) OECD high income Latin America & Caribbean Sub-Saharan Africa South Asia East Asia & Pacific Middle East & North Africa Eastern Europe & Central Asia 62.1 74.1

Ngày tải lên: 22/03/2014, 21:20

... of crayfish (Astacidea) trypsins and a group that includes trypsins from P argus (Palinura), Brachyura, Penaeoidea, Cari-dea and Euphausiacea (Fig 5) Although with low bootstrap values, NJ reconstruc-tion ... Database The nucleotide sequence data for PaTry1a, PaTry1b, PaTry2, PaTry3 and PaTry4 are available in the GenBank database under the accession numbers GU338026, GU338027, GU338028, GU338029 and ... Perera, Center for Marine Research, University of Havana, Calle 16 No 114 e ⁄ 1ra y 3ra, Miramar, Playa, CP 11300 Habana, Cuba Fax: +53 7 2042380 Tel: +53 7 2030617 E-mail: erickpb@comuh.uh.cu Database

Ngày tải lên: 23/03/2014, 03:20

... displays obviously antifungal activity against R solani, Rh nigricans and P parasitica var nicotianae, but does not inhibit F oxysporum, Physalospora piricola, Alternaria alter-nata, Magnaporthe ... vitro antimicrobial assay and in planta studies demonstrated that NtKTI1 is an antifungal protein that increases the resistance of tobacco to fungal attack Results Isolation and characterization ... Guangmin Zhang, Shandong Agricultural University, China Physalos-pora piricola, AIternaria alternata, Magnaporthe grisea, Col-letotrichum orbiculare, Bipolaris sorokiniana, Rh nigricans, P parasitica

Ngày tải lên: 23/03/2014, 03:20