living in ukraine as a student

Cultural Differences A Barrier to Native English Teachers in English as a Foreign Language Context

Cultural Differences A Barrier to Native English Teachers in English as a Foreign Language Context

... European and North America countries, Australia, and Canada, whereas collectivism can be found in parts of Europe such as southern Italy or rural Greece and much of Africa, Asia, and Latin America ... enhance learning 2) Students pay much attention to grammar, vocabulary, and reading They are not active in class and the main purpose they are in class is only to listen They are not willing ... reasons is “face” that Chinese students do not want others laugh at them or at their mistakes because they will lose face in the classroom The concept of face is central in China as well as in

Ngày tải lên: 24/06/2015, 08:16

10 548 0
Elders engaged in begging as a means of livelihood in debre birhan town an exploration of major push factors and their challenges

Elders engaged in begging as a means of livelihood in debre birhan town an exploration of major push factors and their challenges

... and Social Affairs ILO International Labour Organization HAI Help Age International NGO Non-Governmental Organization CSA Central Statics Agency NASW National Social Work Association FGD ... spiritual students travel far away from their home regions they can easily absorb the religious teaching and hence become bright students and the other types are a caste known as haminas or lalibelas ... that physical handicap (54%) were recognized and beggaring was found increasing as age level increases due to different age related health problems In addition to this, Menka (2013) states that

Ngày tải lên: 15/08/2017, 15:10

91 301 0
High school teachers’ pedagogical beliefs in English as a foreign language writing instruction

High school teachers’ pedagogical beliefs in English as a foreign language writing instruction

... including relational, strategic, and textual aspects In term of relational aspect, Trang 6writing should be embedded in a particular social situation used to achieve certain communicative goals ... these materials are more interesting and inspiring than artificial ones In fact, using authentic materials in writing instruction brings about some considerable benefits First, these real–life materials ... these teachers; then functional social–based orientation was positively taken into account (item 11); finally there was a slight favor of process–based (item 12) and interactive social– based (item

Ngày tải lên: 09/01/2020, 11:07

13 45 0
Somatic symptoms in adolescence as a predictor of severe mental illness in adulthood: A long-term community-based follow-up study

Somatic symptoms in adolescence as a predictor of severe mental illness in adulthood: A long-term community-based follow-up study

... implying that the find-ings are robust The results are also in line with two recent American studies Shanahan et  al [25] investi-gated abdominal pain, muscular pain, and headache with several assessments ... received any hospital-based mental health care was associated with somatic symptoms in a linear manner (p < 0.01) (Table 3) Among the specific diagnoses, a statistically significant linear relationship ... depression at base-line [34] as well as to somatic symptoms at baseline [23], and analyses of the follow-up data demonstrated that conflicts with parents and physical/sexual abuse in childhood were associated

Ngày tải lên: 10/01/2020, 13:39

12 31 0
Validation of SCAR marker linked to genic male sterility in marigold: As a forward step towards marker assisted breeding programme

Validation of SCAR marker linked to genic male sterility in marigold: As a forward step towards marker assisted breeding programme

... Assisted Breeding Programme K.M Asha 1* , Anuradha Sane 1 , Tejaswini 1 , D.C Lakshaman Reddy 1 , Sateesha R Patil 2 , Sarvamangala S Cholin 3 , Mahantesha B.N Naika 2 and Raghavendra Gunnaiah 3 1 ... pot plant and as a bedding plant in garden and for its medicinal values (Sowbhagya et al., 2004) Prospects of commercialization of marigold are increasing because of its hardy nature with ease ... nutraceuticals and safe natural orange colorant in food applications (Sowbhagya et al., 2004) In plant breeding, male sterility has been applied as an effective and economical means of pollination

Ngày tải lên: 14/01/2020, 01:42

11 30 0
Effects of home-based play-assisted stimulation on developmental performances of children living in extreme poverty: A randomized single-blind controlled trial

Effects of home-based play-assisted stimulation on developmental performances of children living in extreme poverty: A randomized single-blind controlled trial

... was measured using a calibrated electronic weighing scale (SECA Uniscale, Hamburg, Germany) For children under two years, length was measured using a length-measuring mat on a flat table (SECA 210, ... developmental performance changes sustainable Table 1 Baseline child, maternal and family variables of the control and intervention groups (N = 78) Child variables Maternal variables Family variables ... it. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Authors ’ contributions All authors

Ngày tải lên: 20/02/2020, 21:38

11 21 0
Characteristics of people living in Italy after a cancer diagnosis in 2010 and projections to 2020

Characteristics of people living in Italy after a cancer diagnosis in 2010 and projections to 2020

... Serraino2, Fabio Falcini9, Claudia Casella10, Antonio Giampiero Russo11, Fabrizio Stracci12, Bianca Caruso13, Maria Michiara14, Anna Luisa Caiazzo15, Marine Castaing16, Stefano Ferretti17, Lucia ... Giuseppa Candela29, Anna Clara Fanetti30, Filomena Pala31, Antonella Sutera Sardo32, Massimo Rugge1,33, Laura Botta6 and Luigino Dal Maso2* Abstract Background: Estimates of cancer prevalence are ... Regionale per la Tutela della Salute, Sassari, Italy 21Sudtyrol Cancer Registry, Bolzano, Italy 22Cancer Registry of Latina Province, AUSL Latina, Latina, Italy 23Cancer Registry ASP Ragusa, Ragusa,

Ngày tải lên: 23/07/2020, 02:31

13 21 0
Gamma-glutamyltransferase activity in exosomes as a potential marker for prostate cancer

Gamma-glutamyltransferase activity in exosomes as a potential marker for prostate cancer

... Kawakami1, Yasunori Fujita1, Yoko Matsuda2, Tomio Arai2, Kengo Horie3, Koji Kameyama3, Taku Kato3, Koichi Masunaga4, Yutaka Kasuya4, Masashi Tanaka5, Kosuke Mizutani3*, Takashi Deguchi3 and Masafumi ... added and incubated at room temperature for h with shaking After washing, sample was added in a final volume of 100 μL and incubated at room temperature for h After washing, 0.5 μg/mL biotinylated ... 42 Hino H, Kamiya M, Kitano K, Mizuno K, Tanaka S, Nishiyama N, Kataoka K, Urano Y, Nakajima J Rapid cancer fluorescence imaging using a gammaGlutamyltranspeptidase-specific probe for primary

Ngày tải lên: 06/08/2020, 07:55

12 31 0
Setting up and running engineering businesses in vietnam as a foreigner

Setting up and running engineering businesses in vietnam as a foreigner

... entrepreneur in a foreign country In addition, it discusses the attributes of an engineer that help and hinder in starting up and running a business In the pursuit of a dream, a business plan was crafted ... business operations and in maintaining businesses? This paper will also touch on after stabilizing the business, what has the author been doing to expand the business by implementing Corporate ... into the Navy as Naval Diver He completed his National Service with a rank of full Lieutenant He is currently a student with the National University of Singapore a Son Graduating as a Naval Officer

Ngày tải lên: 16/09/2020, 20:03

10 14 0
Quantitative proteomic analysis shows differentially expressed HSPB1 in glioblastoma as a discriminating short from long survival factor and NOVA1 as a differentiation factor between low-gra

Quantitative proteomic analysis shows differentially expressed HSPB1 in glioblastoma as a discriminating short from long survival factor and NOVA1 as a differentiation factor between low-gra

... F: TGAGGATTTGGAAAGGGTGT, HPRT R: GAGCACACAGAGGGCTACAA, GUSB F: A AAATACGTGGTTGGAGAGCTCATT, GUSB R: CCG AGTGAAGATCCCCTTTTTA, TBP F: AGGATAAGA GAGCCACGAACCA, and TBP R: CTTGCTGCCAGT CTGGACTGT synthesized ... NOVA1 in astrocytomas and oligodendrogliomas a Non neoplastic (NN); b Pilocytic astrocytomas (AST I); c Diffuse astrocytoma (AST II); d Anaplastic astrocytomas (AST III), and e Glioblastoma (GBM, ... low-grade to high-grade gliomas a Non neoplastic (NN); b Pilocytic astrocytoma (ASTI); c Diffuse astrocytoma (ASTII); d Anaplastic astrocytoma (ASTIII), and e Glioblastoma (GBM) short survival (5

Ngày tải lên: 28/09/2020, 16:36

13 13 0
Sách: LIVING IN THE LIGHT  A GUIDE TO PERSONAL AND PLANETARY TRANSFORMATION (SHAKTI GAWAIN with LAUREL KING)

Sách: LIVING IN THE LIGHT A GUIDE TO PERSONAL AND PLANETARY TRANSFORMATION (SHAKTI GAWAIN with LAUREL KING)

... Trang 2LIVING THE IN LIGHTTrang 4A Guide to Personal and Planetary TransformationIN Trang 5New World Library14 Pamaron Way Novato, CA 94949 Revised Edition ©1998 Shakti Gawain and Laurel King ... 7 Trang 19some higher force had taken over and was moving me in an doned and thrilling way.aban-I had always been interested in Eastern philosophy, so aban-I readbooks about Buddhism and Hinduism ... ultimately have the things that myheart desired such as loving relationships, meaningful work, and a Trang 20sense of abundance, and that it would all come about in a moresatisfying way.I was motivated

Ngày tải lên: 06/10/2021, 20:40

258 41 0
NN AN ANALYSIS OF a SUGGESTED TRANSLATION OF CHAPTERS 1, 2  3 FROM THE BOOK “LIVING IN THE LIGHT  a GUIDE TO PERSONAL TRANSFORMATION” BY SHATKI GAWAIN AND LAUREL KING, 1998

NN AN ANALYSIS OF a SUGGESTED TRANSLATION OF CHAPTERS 1, 2 3 FROM THE BOOK “LIVING IN THE LIGHT a GUIDE TO PERSONAL TRANSFORMATION” BY SHATKI GAWAIN AND LAUREL KING, 1998

... Your Imagination to Create WhatYou Want in Life (1978) It has been a bestselling book for nearly 40 years In addition, Laurel King was the one who helped Gawain in the writingprocess and came up ... ideas in the translation should match theoriginal as closely as possible (This is particularly important in translatinglegal documents, guarantees, contracts, etc.) But differences in languagestructure ... “Translation is the replacement of textual material in one language (SL) by equivalent textual material in another language (TL).” 2.1.2.1 Full vs Partial Translation (i) In a full translation,

Ngày tải lên: 29/03/2022, 12:50

76 8 0
The traditional shopping street in tokyo as a culturally sustainable and ageing friendly community

The traditional shopping street in tokyo as a culturally sustainable and ageing friendly community

... 9an association with a self-governing system19 as well as a co-governing mechanism in laboration with the local authorities, such as the maintenance of sidewalks and urban fur-niture as well as ... points in the demographic transition East Asia began earlier and is farther along, foremost Japan, while the trend in South and Southeast Asian countries started later and they are currently at ... cultural inluences among friends, schoolmates, colleagues or neighbours of the same generation As such, a community can best retain and advance its cultural capital if it has a erational and interacting

Ngày tải lên: 19/10/2022, 17:51

22 2 0
using-the-e-in-stem-as-a-catalyst-for-science-and-mathematics-curriculum-reform-in-a-large-school-district

using-the-e-in-stem-as-a-catalyst-for-science-and-mathematics-curriculum-reform-in-a-large-school-district

... Study is drawing to a close, the Coaches and principals report that the teacher collaboration is continuing In addition, having students work collaboratively in teams was a first for many teachers, ... Following a year of collaboration and planning, a pilot initiative emerged called Engaging Youth through Engineering or EYE The goal of EYE was and still is to engage area youth in grades 4-9 in ... on applied problem solving, mathematics education, and assessment and evaluation He teaches graduate courses in learning, assessment, research methods, and data analysis He currently is the lead

Ngày tải lên: 20/10/2022, 13:08

11 3 0
Graphic Display of Linguistic | Information in English as a Foreign Language Reading ~~

Graphic Display of Linguistic | Information in English as a Foreign Language Reading ~~

... conveying ideas through a spatial graphic display—avisual and spatial arrangement of information—rather than throughwritten linear text Waller (1981) noted that since readers can see—notread—ideas, ... rearranging a linear sen- in-FIGURE 1 A Linear Sentential Representation and a Spatial Graphic Representation Trang 7tential text with coordinating conjunctions into a spatial graphic displaymore ... did, and EFL readers were able toaccurately rearrange a linear sentential text into a spatial display byusing the instruction manual The methods of displaying information can be distinguished based

Ngày tải lên: 22/10/2022, 19:15

26 1 0
Graphic Display of Linguistic Information in English as a Foreign Language Reading

Graphic Display of Linguistic Information in English as a Foreign Language Reading

... conveying ideas through a spatial graphic display—avisual and spatial arrangement of information—rather than throughwritten linear text Waller (1981) noted that since readers can see—notread—ideas, ... rearranging a linear sen- in-FIGURE 1 A Linear Sentential Representation and a Spatial Graphic Representation Trang 7tential text with coordinating conjunctions into a spatial graphic displaymore ... did, and EFL readers were able toaccurately rearrange a linear sentential text into a spatial display byusing the instruction manual The methods of displaying information can be distinguished based

Ngày tải lên: 23/10/2022, 01:21

26 3 0
Setting up and running engineering businesses in vietnam as a foreigner

Setting up and running engineering businesses in vietnam as a foreigner

... Vietnam, Lee manages radar systems, radar training system and radar fusion software projects for Vietnam Maritime Administration, Vietnam Navy and Vietnam Naval Academy Lee had designed small ... Depending on the business activity, you may need to have a local coordinator for assistance In the minimum, you need a assistance to transfer cash Issues like lodging, transportation and food are also ... to maintain all the expenses Today, the author has paid off his housing loan in Singapore, bought an apartment and built a holiday house in Vietnam He also owes several vehicles He also travels

Ngày tải lên: 23/10/2022, 09:42

10 8 0
Policy And Practices In English As A Medium Of Instruction In Vietnamese Tertiary Efl Contexts

Policy And Practices In English As A Medium Of Instruction In Vietnamese Tertiary Efl Contexts

... told me that what I gained from my PhD candidature was not a thesis but what I would do after my graduation as a Doctor I would like to thank the Vietnamese Ministry of Education and Training, the ... analysis indicated that foreign language teaching (FLT) is a major focus of the Vietnamese government’s educational reform, and that EMI is considered as a way to achieve both its educational ... borrowing’ in EMI programs 170 Trang 74.2.7 The role of EMI teachers’ training and selection in ensuring the quality of EMI courses 172 4.3 Chapter summary 174 CHAPTER 5: QUANTITATIVE DATA ANALYSIS:

Ngày tải lên: 29/10/2022, 01:36

11 7 0
hypersensitivity to dna damage in antephase as a safeguard for genome stability

hypersensitivity to dna damage in antephase as a safeguard for genome stability

... DNA damage DNA damage causes rapid APC/CCdh1activation in antephase Excessive DNA damage results in activation of the Anaphase-promoting complex/Cyclosome together with its co-factor Cdh1 (APC/CCdh1) ... DNA damage causes rapid APC/CCdh1activation in antephase (a) Direct degradation of Cyclin B1 in antephase cells depleted for luciferase, Cdh1 or Cdc20 that were irradiated with 1 Gy Antephase ... 50-GCCTAGCAGCCGACTTAGAA-30/reverse: 50-CTCACCGGGTCAGTGAAAAA-30 GAPDH forward: 50-TCGGTTCTTGCCTCTTGTC-30/reverse: 50-CTTCCATTCTGTCTTCCACTC-30 Data availability.The authors declare that all data supporting

Ngày tải lên: 04/12/2022, 10:34

10 5 0
Living In The Light_ A Guide To Personal Transformation ( Pdfdrive ).Pdf

Living In The Light_ A Guide To Personal Transformation ( Pdfdrive ).Pdf

... Library of Congress-in-Publication Data Gawain, Shakti, 1948 — Living in the light : a guide to personal and planetary transformation / Shakti Gawain, with Laurel King — Completely rev. and updated. ... 7 Trang 19some higher force had taken over and was moving me in an doned and thrilling way.aban-I had always been interested in Eastern philosophy, so aban-I readbooks about Buddhism and Hinduism ... ultimately have the things that myheart desired such as loving relationships, meaningful work, and a Trang 20sense of abundance, and that it would all come about in a moresatisfying way.I was motivated

Ngày tải lên: 21/02/2023, 14:05

258 34 0
w