living in a networkcentric

... 30 Jan 2017. 22 Takahashi S, Nakamura M, Yonekura Y, Tanno K, Sakata K, Ogawa A, Kobayashi S Association between relocation and changes in cardiometabolic risk factors: a longitudinal study in ... related factors after the Great East Japan earthquake and tsunami PLoS ONE 2014;24:9. 24 Kishi M, Aizawa F, Matsui M, Yokoyama Y, Abe A, Minami K, Suzuki R, Miura H, Sakata K, Ogawa A Oral health-related ... smoking on the prevalence and intraoral distribution of Candida albicans J Oral Pathol 1984;13:265 –70. 37 Srivastava B, Bhatia HP, Chaudhary V, Aggarwal A, Kumar Singh A, Gupta N Comparative Evaluation

Ngày tải lên: 04/12/2022, 16:05

... CCCGGTACAGAGCAGGATTACAACA VT1 r AGCGATGCAGCTATTAATAA VT2 r TACACAGGAGCAGTTTCAGACAGT eae l AAAAACGCTGACCCGCACCTAAAT bfp A2 l TTTTGTTTGTTGTATCTTTGTAA IpaH IV GCCGGTCAGCCACCCTCTGAGAGTAC Table 2 Break-point ... H10 strains – one aatA and astA, one aatA – were isolated from cases O171 : NM aatA and EAF was isolated from one control and O171 : H7 aatA of less than 75 % similarity by PFGE was isolated from ... bywastewater-irrigated agriculture or aquaculture activities in a suburban area of Hanoi, Vietnam In particular, we aimed to determine the role of DEC by carrying out a detailed characterization.

Ngày tải lên: 04/03/2024, 09:10

... (Phoca sibirica) [3], and various other animals CDV killed more than 10,000 Cas-pian seals (Phoca caspica) in year 2000 [4], and decimated an African wild dog (an endangered species) breeding pack ... christyhoude@yahoo.com * Corresponding author Abstract Background: Mortality rates have differed during distemper outbreaks among free-ranging raccoons (Procyon lotor) living around a large Chicago-area ... Trang 1Open AccessResearch Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large

Ngày tải lên: 18/06/2014, 22:20

... currently living at home so that data on survival and living arrangements one year after the baseline visit were available for all (Figure 1) The main characteristics of the participants at the baseline ... dependence in the BADLs at the time the phone call Trang 4was made The latter was investigated by using theBADL scale and was defined as any decline in the BADL score at follow-up as compared to baseline ... using the telephone, shopping, preparing meals, housekeeping, doing laundry, taking medications, managing transportation and handling money [36] When any fall and any ED admission were taken as

Ngày tải lên: 20/06/2014, 15:20

... partici-pants had made a residential move made an important difference in migrants’ risk-taking behaviors A certain kind of“mentality” nascent of a setting characterized by lack of syringe access ... unprotected casual/exchange sex The first is defined as injecting drugs in the past year with a syr-inge that someone else has already used The second is defined as past-year unprotected vaginal or anal ... Federal poverty line; 2) homelessness (living on the street, in a shelter, or a single room occupancy apartment) in the past 12 months; and 3) incarceration in a prison or jail for at least one day

Ngày tải lên: 11/08/2014, 18:20

... bias in codon usage and amino-acid usage Figure 3 Influence of mutational bias in codon usage and amino-acid usage (a) Percentage use of AT-rich codons in the four marine picocyanobacteria Amino ... were obtained from the Yn00 program of the PAML 3.13 package [47] Additional data files The following additional data are available with the online version of this article Additional data file ... documented example of such a process in a free-living organism. Results: Our results clearly indicate that genome reduction has been accompanied by an increased rate of protein evolution in P marinus

Ngày tải lên: 14/08/2014, 14:21

... Seidentificaron14estudioscon3.539participantesqueutilizabanelejercicioy/olamodificación ambientaldeformaúnicaocombinadaconotrasintervenciones.Ambasintervencionesdemostraron efectividadenlareduccióndelnúmerodecaídas,desdeunenfoquecombinado Noobstante,hacenfaltamásestudiosparaasegurarlaefectividaddelusodelejercicioydelentorno ... Durantejuliode2014seconsultaronlasprincipalesbasesbibliográficasyrecursosespecializadossobre eltema.Seseleccionaronensayoscontroladosaleatorizadossobreintervencionesdestinadasaprevenir caídas,queincluíanelejerciciofísicoy/omodificacionesdelentorno,aplicadasenestapoblación.Dos ... supervisado Tecnología ambien-tal/entorno N.◦de caídas N.◦de personas quesecaen N.◦depersonas conmúltiples caídas Lesiones asociadas Fracturas asociadas Fracturasde cadera asociadas 200230 Neyens Study

Ngày tải lên: 25/08/2016, 21:43

... animals and the places in which they lived have changed over time Animals’ teeth, for example, are adapted to eating certain kinds of food Meat-eating animals have teeth that cut and tear Plant-eating ... habitat A habitat is like a balance On one side of the balance are the things that live in the habitat On the other side are the things that the habitat provides If the balance has equal things ... tear Plant-eating animals have teeth that grind only Comparing teeth of living things to those of dinosaurs shows what dinosaurs ate The Badlands in South Dakota used to be warm and wet all the

Ngày tải lên: 20/04/2017, 15:09

... children, leaving the family in dire straits The village in which Ha was born is coastal, with almost no farm land, and most livelihoods are based around fishing Her mother scraped a living as a small-scale ... that she work in China or Malaysia Instead she remained in Hanoi, taking a series of unsatisfactory, marginal jobs To secure a better job, however, would mean getting ID, and this required that ... wages and cramped living conditions, separated from his family, he stayed in Hanoi because there was no work in Quang Xuong While he struggled to make a living in Hanoi, Mr Vinh’s wife maintained

Ngày tải lên: 16/12/2017, 00:53

... result in paralysis of the muscles of the chest and abdomen possibly leading to death. Azadinium spp a Nausea vomiting, severe diarrhea, and abdominal cramps NSP Brevetoxin Karenia spp Nausea, temperature ... 2003) orfavorable winds (Raine et al., 2010) Using this empirical approach and 518 Coastal and Marine Hazards, Risks, and Disasters Trang 25recognizing that DSP-causing Dinophysis blooms (Table 17.1) ... and Mynett (2006), Blauw et al (2006), Blauw et al (2010) Dinophysis acuminata Western Andalucia, Spain Gutierrez-Estrada, (2007) Trang 21Lyngbya majuscula Deception Bay,Queensland, Australia

Ngày tải lên: 30/12/2017, 14:12

... were killed in a caraccident, leaving her with two young nieces to raise Casey was single, with in-a glin-amorous, exciting, in-and demin-anding life thin-at left no time for in-anythingmore Suddenly ... fork at all in the road—only an abrupt turn thatproduces a dramatic change in our fortunes and in our lives We have aheart attack, for example, or develop cancer, and we face difficult medicaldecisions ... ap-Library of Congress Cataloging-in-Publication Data Beazley, Hamilton, date. No regrets : a ten-step program for living in the present and leaving the past behind / Hamilton Beazley. Trang 6To

Ngày tải lên: 23/05/2018, 13:49

... experienced in different places in Southeast Asian, including seasonal floodplain inundation, irregular riverbank overflow, flash floods in urban areas, landslides and flash floods in mountain areas and ... unclear In Chapter 9, Mohammad Imam Hasan Reza, Er Ah Choy and Joy Jacqueline Pereira examine the impact of severe floods in Johor State, Malaysia, an area of the country which is a key destination ... These include human capital (labour resources, skills, health and education), financial capital (including remittances and access to credit) and social and polit-ical capital (which mediate access

Ngày tải lên: 17/01/2020, 08:51

... World: Provincial Cosmopolitans (2013). Trang 14Making a Living, Making a DifferenceTrang 16A  female servant also testified that the same day she had observed Ingeborg lying in great pain, but that ... GaW dataset, case 541 Original source: Criminalia E V aa: 38, Göta Court of Appeal (Göta hovrätt), main archive, Regional State Archives in Vadstena Thanks to Jan Mispelaere, who found this case. ... Trang 2Making a Living, Making a DifferenceTrang 4Making a Living, Making a Difference Gender and Work in Early Modern European Society E D I T E D BY M A R I A   ÅG R E N Trang 51Oxford

Ngày tải lên: 17/01/2020, 15:38

... experienced in different places in Southeast Asian, including seasonal floodplain inundation, irregular riverbank overflow, flash floods in urban areas, landslides and flash floods in mountain areas and ... unclear In Chapter 9, Mohammad Imam Hasan Reza, Er Ah Choy and Joy Jacqueline Pereira examine the impact of severe floods in Johor State, Malaysia, an area of the country which is a key destination ... These include human capital (labour resources, skills, health and education), financial capital (including remittances and access to credit) and social and polit-ical capital (which mediate access

Ngày tải lên: 20/01/2020, 14:50

... Trang 1R E S E A R C H A R T I C L E Open AccessOral diseases and oral health related behaviors in adolescents living in Maasai population areas of Tanzania: a cross-sectional study Lutango ... symptoms Oral clinical examination The principal investigator (LS) performed all clinical ex-aminations The participant was examined in natural day light under field conditions, sitting on a chair, ... During training for scoring of dental erosion, the inter-examiner (between LS and AKJ) Cohen’s Kappa for all examined teeth during examination was 0.82 Oral clin-ical examination was carried out

Ngày tải lên: 01/02/2020, 04:06

... developmental performance changes sustainable Table 1 Baseline child, maternal and family variables of the control and intervention groups (N = 78) Child variables Maternal variables Family variables ... it. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Authors ’ contributions All authors ... January 2011) and macros Geneva: WHO Anthro; 2011. 44 Bennett S, Myatt M, Jolley D, Radalowicz A Data management for surveys and trial: a practical primer using EpiData Odense: The EpiData Association;

Ngày tải lên: 20/02/2020, 21:38

... experienced in different places in Southeast Asian, including seasonal floodplain inundation, irregular riverbank overflow, flash floods in urban areas, landslides and flash floods in mountain areas and ... unclear In Chapter 9, Mohammad Imam Hasan Reza, Er Ah Choy and Joy Jacqueline Pereira examine the impact of severe floods in Johor State, Malaysia, an area of the country which is a key destination ... These include human capital (labour resources, skills, health and education), financial capital (including remittances and access to credit) and social and polit-ical capital (which mediate access

Ngày tải lên: 02/03/2020, 12:22

... De Angelis3, Chiara Panato2, Carlotta Buzzoni4,5, Riccardo Capocaccia6, Silvia Francisci3, Anna Gigli7, Manuel Zorzi1, Giovanna Tagliabue8, Diego Serraino2, Fabio Falcini9, Claudia Casella10, Antonio ... Mazzoleni21, Fabio Pannozzo22, Rosario Tumino23, Mario Fusco24, Paolo Ricci25, Gemma Gola26, Adriano Giacomin27ˆ, Francesco Tisano28 , Giuseppa Candela29, Anna Clara Fanetti30, Filomena Pala31, ... Antonio Giampiero Russo11, Fabrizio Stracci12, Bianca Caruso13, Maria Michiara14, Anna Luisa Caiazzo15, Marine Castaing16, Stefano Ferretti17, Lucia Mangone18, Giuseppa Rudisi19, Flavio Sensi20,

Ngày tải lên: 23/07/2020, 02:31

... Trang 2LIVING THE IN LIGHTTrang 4A Guide to Personal and Planetary TransformationIN Trang 5New World Library14 Pamaron Way Novato, CA 94949 Revised Edition ©1998 Shakti Gawain and Laurel King ... Congress-in-Publication Data Gawain, Shakti, 1948 — Living in the light : a guide to personal and planetary transformation / Shakti Gawain, with Laurel King — Completely rev. and updated. ISBN 1-57731-046-2 (alk ... 7 Trang 19some higher force had taken over and was moving me in an doned and thrilling way.aban-I had always been interested in Eastern philosophy, so aban-I readbooks about Buddhism and Hinduism

Ngày tải lên: 06/10/2021, 20:40

... “Translation is the replacement of textual material in one language (SL) by equivalent textual material in another language (TL).” 2.1.2.1 Full vs Partial Translation (i) In a full translation, ... using semantic information to aid in the translation of data in one representation or data model to anotherrepresentation or data model Example: She is a good mother, and she always takes care ... Your Imagination to Create WhatYou Want in Life (1978) It has been a bestselling book for nearly 40 years In addition, Laurel King was the one who helped Gawain in the writingprocess and came up

Ngày tải lên: 29/03/2022, 12:50