linked list implementation of list adt in c

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... levels of internal switching nodes. While such switches can be made to accommodate large numbers of communicating processors, they add the characteristic NUMA remote memory access delay. The difficulties ... that task. 3.2. Inter-Process Communication Inter-process communication (IPC) in Mach is defined in terms of ports and messages. These constructs provide for location independence, security and data ... user-to-kernel copy operations. In contrast, Mach uses the bulk of its physical memory as a cache of secondary storage data pages. The effect of this kind of caching on the performance of UNIX and...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... 19:19 http://www.sjtrem.com/content/19/1/19 Page 5 of 5 ORIGINAL RESEARCH Open Access Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators Veronica ... veronica.lindstrom@ki.se 1 Karolinska Institutet, Department of Clinical Science and Education and Section of Emergency Medicine Södersjukhuset, Södersjukhuset, Stockholm, Sweden Full list of author ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar •...

Ngày tải lên: 25/10/2012, 10:02

5 498 0
The challenges for implementation of good manufacturing practices by local pharmaceutical manufactures in vietnam

The challenges for implementation of good manufacturing practices by local pharmaceutical manufactures in vietnam

... and finally the inconvenience or incapability of firms in accessing the needed information. • Financial challenges 24 Figure 2.1: 5g-P Principle in Quality Assurance of Pharmaceutical products Source: ... Practices GSP Good Storage Practices GDP Good Distribution Practices GPP Good Pharmacy Practices Good Prescribing Practices GCP Good Clinical Practices SOP Standard Operating Procedures FIP International ... Practices GSP Good Storage Practices GDP Good Distribu- tion Practices GPP Good Pharmacy Practices Quality Assurance of Clinical Therapy GCP Good Clinical Practices GPP Good Prescri- bing...

Ngày tải lên: 06/11/2012, 10:26

72 932 2
Radioactive waste in the Barents and Kara Seas - Russian implementation of the global dumping regime

Radioactive waste in the Barents and Kara Seas - Russian implementation of the global dumping regime

... embarking upon his project of slackening restrictions on access to bureaucratic decision-making. The Chernobyl accident the following year had channelled much of the public disapproval into the ... deposition or, in the case of spent fuel, reprocessing. 15 In practice, it also involves treatment capacity for con- centrating or solidifying liquid waste and for compacting solid waste to facilitate storage. ... used in cooling, incineration or deactivation of radioactive installations – has been dis- posed of in the Barents Sea since the mid-1960s. This past dumping is a matter of substantial concern in...

Ngày tải lên: 01/11/2013, 09:20

21 489 0
Motion Control Theory Needed in the Implementation of Practical Robotic Systems

Motion Control Theory Needed in the Implementation of Practical Robotic Systems

... Friction as a complex function of velocity. Figure 4.2a shows the model of friction used in physics classes in which there is one static coefficient and one sliding or rotating coefficient. Figure ... particularly unacceptable is systems such as CNC milling machines where the result is cutting into a part, so the use of S-curves is imperative. Chapter 3 The State of the Motor Control Industry ... could locate, with 230 million pulses per revolution, an accumulative accuracy of 1 arc/second or less and 0.005625 arc-second resolution. Finally, the choice of controller greatly affects...

Ngày tải lên: 05/11/2013, 21:15

92 401 0
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

... Implementation Efficiency 0 5 10 15 20 25 30 35 40 45 50 0 10 20 30 40 50 60 Sample Event CPU Usage (%) udt sending udt receiving tcp sending tcp receiving • CPU usage of UDT and TCP – UDT ... product networks. pRTT S 2 3 Outline • TCP’s inefficiency in grid applications • UDT • Design issues • Implementations issues • Conclusion and future work TCP and AIMD • TCP has been very successful ... //error processing } int client = socket(AF_INET, SOCK_STREAM, 0); connect(client, (sockaddr*)&serv_addr, sizeof(serv_addr)); If (-1 == send(client, data, size, 0)) { //error processing } ...

Ngày tải lên: 15/01/2014, 15:59

32 582 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf

Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf

... experiences observed in the earlier AMEDD low back pain guideline demonstra- tion, we identified six critical factors that influence how successful an MTF will be in integrating new practices into its clinical ... 85 Reported Changes in Clinical Practices 87 Changes in Referral Patterns 87 Changes in Asthma Indicators Monitored by the Sites 88 Changes in Asthma Medication Prescriptions 88 Analysis of Effects ... 107 CHAPTER SIX Synthesis of Findings from the Demonstration 109 Findings on the Implementation Process 109 Implementing the Guideline Practices 109 Six Critical Success Factors 110 Effects of...

Ngày tải lên: 17/02/2014, 22:20

212 446 0
Tài liệu Implementation of the Diabetes Practice Guideline in the Army Medical Department - Final Evaluation ppt

Tài liệu Implementation of the Diabetes Practice Guideline in the Army Medical Department - Final Evaluation ppt

... diabetes practice guideline. Adoption of a practice guideline based on these measures predicts a number of changes in clinical practice (Table 1.2). Table 1.2 Changes in Clinical Practices Predicted ... Practice Guideline Implementation Initial Assessment and Glycemic Control Increased rates of primary care clinic visits for diabetes patients during the first quarter of practice guideline implementation, ... of the DoD/VA Diabetes Practice Guideline 5 1.2. Changes in Clinical Practices Predicted by Practice Guideline Implementation 6 1.3. Profiles of the Military Treatment Facilities Participating...

Ngày tải lên: 17/02/2014, 22:20

182 355 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

... Unit, CRCHUL ⁄ CHUQ, Faculty of Medicine, Laval University, Que ´ bec, Canada 2 Quebec Proteomic Center, CRCHUL ⁄ CHUQ, Faculty of Medicine, Laval University, Que ´ bec, Canada 3 Cancer Research Center, ... (PTP) CD45 [12] and the tyrosine kinase of the cellular Src (c- Src) fam- ily p56 lck [13]. In hepatocarcinoma cells, kinase activity was detected in DPP IV immunoprecipitates [14]. In liver parenchyma, ... processes including chemokine regulation [19] and maintenance of physiological glucose homeos- tasis [20]. Knockout mice lacking the gene for DPP IV show enhanced insulin secretion and accelerated...

Ngày tải lên: 19/02/2014, 07:20

12 738 0
Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx

Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx

... demonstrating the presence of C, H, and S in the corresponding clinical forms of corneal dystrophies (LCD1, GCD2 and GCD1, respectively). Chemicals Trifluoroacetic acid and acetonitrile (HPLC grade) ... of the cornea resulting in loss of its transparency. Based upon their clinical characteristics, hereditary corneal dystrophies form a distinctive group of corneal diseases. Some of them involve the ... a direct inhibitory effect of this nine-amino-acid sequence, or to disequilibrium in the hydrophobic-hydrophilic balance of the truncated peptide. Based on the importance of the two Val residues in...

Ngày tải lên: 21/02/2014, 01:21

8 471 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

... AGGTGCAGCAGCTTCAGTTT Dusp16 pre-mRNA forward, CAGTGCTGGAATTGTACGTGA reverse, AGTCCATGAGTTGGCCCATA Egr1 forward, CCTATGAGCACCTGACCACA reverse, AGGCCACTGACTAGGCTGAA Egr1 pre-mRNA forward, GAGCAGGTCCAGGAACATTG reverse, GGGATAACTCGTCTCCACCA Ndrg1 ... forward, CCCACGTGTTGAGATCATTG reverse, GAGGAACAGCAGAGAGCCTC Cxcl10 pre-mRNA forward, AGCAGAGGAAAATGCACCAG reverse, CACCTGGGTAAAGGGGAGTGA Dusp16 forward, GCTCCGCCACTATTGCTATT reverse, AGGTGCAGCAGCTTCAGTTT Dusp16 pre-mRNA forward, ... TTTGATGCAGGTGTTTGAGG reverse, CCACCTGTAGGTCTGGCA Sqstm1 forward, CCTTGCCCTACAGCTGAGTC reverse, CTTGTCTTCTGTGCCTGTGC Ifrd1 forward, GTTTGAATTGGCCAGAGGAA reverse, TCTGTTGGAAAATCCCGTTC Cxcl10 forward,...

Ngày tải lên: 07/03/2014, 03:20

12 562 0
Implementation of the Waste Electric and Electronic Equipment Directive in the EU pot

Implementation of the Waste Electric and Electronic Equipment Directive in the EU pot

... additional costs of managing a national clearing house, separate collection containers, extra logistics etc. and point to economies of scale of the collective approach, especially in small countries ... accommodate both financing systems within a single organisation. Various options are possible for the fee structure – actual costs of recycling, projected costs of recycling per product category, ... WEEE schemes, all have indicated the importance of building systems that meet local specifics of culture, geography and industry, and that take into account existing practices of waste collection....

Ngày tải lên: 08/03/2014, 13:20

108 458 0

Bạn có muốn tìm thêm với từ khóa:

w