letter from a comptroller requesting a raise

How to setup a Linux system that can boot directly from a software RAID

How to setup a Linux system that can boot directly from a software RAID

... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... Minor RaidDevice State removed active sync /dev/hda1 Replacing the failed disk When a new disk to replace the failed one is available it can be installed into the system, partitioned to have the ... [root@fedora4 giotex]# mdadm manage /dev/md0 add /dev/hdc1 mdadm: hot added /dev/hdc1 [root@fedora4 giotex]# mdadm manage /dev/md1 add /dev/hdc2 mdadm: hot added /dev/hdc2 [giotex@fedora4 ~]$ cat...

Ngày tải lên: 18/09/2012, 10:11

14 568 1
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf

John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf

... stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another over time The Japanese have ... She added another value: that many women care about social issues and will patronize a company that cares.19 Greg Carpenter and Kent Nakamoto have challenged a core assumption of marketers that ... notion that a company wins by building a relevant and sustainable competitive advantage.17 Having a competitive advantage is like having a gun in a knife fight This is true, but today most advantages...

Ngày tải lên: 21/09/2012, 17:33

226 1,4K 7
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

... premises Medical wastes include injurious medical wastes and common wastes  Injurious medical wastes are medical wastes which contain factors that can harm man’s health and environment Those factors ... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment ... houses are non-standard, unsanitary and highly infectious In some areas, medical wastes are urgent matters because there have been no places for wastes to be gathered even in provincial hospital...

Ngày tải lên: 23/09/2012, 15:38

10 723 0
Perfect Bound Press One-Letter Words A Dictionary

Perfect Bound Press One-Letter Words A Dictionary

... only known plant sources are yeast, alfalfa, and two Japanese seaweeds—wakame and kombu —American Medical Association 29 n A blood type Genes for types A and B are dominant, and will always be expressed ... X X is an incorrect answer on a test, and it’s a rating for an adult movie X is a power of magnification, an axis on a graph, and a female chromosome It is a multiplication operator, a letter ... Linear Algebra and Matrix Theory” A 48 n (astronomy) A class of white stars When an astronomer speaks of a class A star, he refers to white stars like Sirius and Vega, in whose spectra we see a...

Ngày tải lên: 05/10/2012, 09:56

267 625 5
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients AVNRT ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying...

Ngày tải lên: 03/11/2012, 11:44

9 681 0
A visit from a pen pal

A visit from a pen pal

... vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence (Sân nhà họ ngăn cách với nhà máy hàng rào cao.) -» separate (adj): riêng ... eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations: Hiệp hội nước Đông Nam Á Website học ... atmosphere over the party was warm and friendly (Không khí b a tiệc đầm ấm thân mật.) to pray (v): cầu nguyện; cầu khấn Ex: We all prayed that she would soon recover (Tất cầu nguyện cho cô mau...

Ngày tải lên: 17/01/2013, 09:58

5 1,7K 0
English Proverbs from A to Z

English Proverbs from A to Z

... time Good management is better than good income Great minds think alike Great oaks grow from little acorns Large successful operations can begin in a small way H Half a loaf is better than none ... make the man Appearances can be deceiving Constant occupation prevents temptation When you work you avoid temptation D Dead men tell no tales A dead person cannot cause difficulties by revealing ... appearances E Early to bed and early to rise makes a man healthy, wealthy and wise Easier said than done What is suggested sounds easy but it is more difficult to actually it Empty vessels make...

Ngày tải lên: 18/06/2013, 01:26

5 624 1
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to look at the ... subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to ... d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...

Ngày tải lên: 21/06/2013, 01:27

2 1,1K 0
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... The past simple with wish + Give example and explain the way to use Ex : a You are a student ( I wish I were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past ... visited * Cues : - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they will ... wish + S + Past subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I...

Ngày tải lên: 21/06/2013, 01:27

3 936 0
Unit 1_ A visit from a penpal

Unit 1_ A visit from a penpal

... Date: Name: _ English 9_ Unit  Fill in each blank with one suitable word: Japan _four main islands Hokkaido, Honshu, Shikoku, and Kyushu A Japanese lunch is a light ... Communist north, and (REUNIFICATE) _occurred in mid-1975  Rewrite these sentences: Lan & her pen-pal, Maryam started corresponding over two years ago Lan & her pen-pal, Maryam have ... Democratic Republic of Vietnam (North Vietnam) and the former Republic of Vietnam (South Vietnam) Education in Vietnam is universal and _ for children ages to 11 The _language of...

Ngày tải lên: 26/06/2013, 01:27

6 554 0
Techical analysis from a to z

Techical analysis from a to z

... technical analysis thirty years ago, many people considered technical analysis just another 1960's adventure into the occult Today, technical analysis is accepted as a viable analytical approach ... technical analysis thirty years ago, many people considered technical analysis just another 1960's adventure into the occult Today, technical analysis is accepted as a viable analytical approach ... money managers and home managers, students and strikers, doctors and dog catchers, lawyers and landscapers, and the wealthy and the wanting This breadth of market participants guarantees an element...

Ngày tải lên: 13/08/2013, 15:59

227 663 0
Evaluation of Nutrient Loads from a Citrus Orchard in Japan

Evaluation of Nutrient Loads from a Citrus Orchard in Japan

... station by Japan Meteorological Agency (2008) Load Estimations Load evaluation of Case was calculated by water discharge and nutrient load from our only weekly research data (Table 1) In the Case ... (Cases and 4) by applying the least-squares method to antilogarithmic and logarithmic regression curves The Case evaluation was made on an antilogarithm scale, and Case used a logarithmic scale ... water discharge was almost same as the base flow We therefore need a way of accurately quantifying nutrient load from farmland during rainfall events We can obtain sequential nutrient load data...

Ngày tải lên: 05/09/2013, 10:15

10 425 0
Nutrient Loss from a Tea Plantation Area in Japan

Nutrient Loss from a Tea Plantation Area in Japan

... stable As a result, the annual discharge of nitrogen and phosphorus from the tea plantation area were estimated to be 535kgN/ha/year and 21kgP/ha/year, respectively, indicating that the tea plantation ... tea plantation area, fertilizer was mainly applied in two seasons, which are early spring during February and March for basal fertilization and summer during August and September for additional ... Agricultural Center, 26, 34-41 (in Japanese) Matsuo H., Baba Y., Nakamura Y., Tokunaga T., Kitamori S., Hirata T and Nishikawa M (2000) The changes of nitrogen flux for decreasing of the annual amount...

Ngày tải lên: 05/09/2013, 10:15

10 347 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...

Ngày tải lên: 05/09/2013, 10:15

9 525 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

... water is provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation ... if air looses enthalpy, water would be heated Thus, in a process where air and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the adiabatic ... recirculated to maintain its temperature at the adiabatic saturation temperature of inlet air Because the sensible heat load is transferred to the water surface and transformed into evaporation latent...

Ngày tải lên: 05/09/2013, 16:10

28 654 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

... show the minimum and maximum annual average acceptance rates to be 999.2 mg/year and 1000.8 mg/year respectively The mean, variance, and standard deviation are 1000 mg/year, 0.0504, and 0.225 respectively ... generation rate, k and potential methane generation capacity, Lo Emission type Landfill type CAA Conventional CAA Arid area Inventory Conventional Inventory Arid area Inventory Wet (bioreactor) Source: ... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter,...

Ngày tải lên: 05/09/2013, 16:11

8 542 0
w