kj kg of selected hydrocarbons at 25°c
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... sodium phosphate, pH 6.0, at 24°C) Benzyl alcohol Wild-type Km kcat kcat ⁄ Km Y78A Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L315A Km kcat kcat ⁄ Km F501A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km ... monomeric glycoprotein of 70 kDa with dissociable flavin-adenine dinucleotide (FAD) as cofactor that catalyzes the oxidation of a variety of aromatic and aliphatic polyunsaturated alcohols to their ... H546R GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC...
Ngày tải lên: 07/03/2014, 11:20
Tài liệu Color Atlas of Pharmacology (Part 25): Therapy of Selected Diseases pptx
... an essentially complete sympathetic denervation), loss of sympathetic vasomotor control can be compensated by administration of sympathomimetics Lüllmann, Color Atlas of Pharmacology © 2000 Thieme ... degradation The typical gout attack consists of a highly painful inflammation of the first metatarsophalangeal joint (“podagra”) Gout attacks are triggered by precipitation of sodium urate crystals ... Nitrate tolerance O2-supply O2-demand Relaxation of coronary spasm Vasorelaxation Nitrates e.g., Nitroglycerin (GTN), Isosorbide dinitrate (ISDN) A Effects of nitrates p Rest Caantagonists Sympathetic...
Ngày tải lên: 15/12/2013, 13:15
Charles Darwin: His Life in an1Charles Darwin: His Life in anAutobiographical Chapter, and in a Selected Series of His Published Letters, by Charles Darwin, Edited by Sir Francis Darwin This eBook is for the use of anyone anywhere at no cost and with potx
... gnat that God designed that that particular swallow should snap up that particular gnat at that particular instant? I believe that the man and the gnat are in the same predicament If the death ... what is new nor admires what is old, and that hates every kind of imposture So I thought my nature had a kind of familiarity and relationship with Truth." BACON (Proem to the Interpretatio Naturæ.) ... Henry and Parkes' Chemical Catechism The subject interested me greatly, and we often used to go on working till rather late at night This was the best part of my education at school, for it showed...
Ngày tải lên: 23/03/2014, 05:20
descriptions of selected accidents that have occurred at nuclear reactor potx
Ngày tải lên: 31/03/2014, 14:20
Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx
... approximate mutation rate in our dataset was calculated based on the number of new alleles in G11 (and confirmed with simulations), which yielded a mutation rate of 10À7 Therefore, a stepwise mutation ... and at each generation (one generation per year), 15 males and 30 females out of about 100 candidates of each sex were chosen as parents Signature of selection in chicken 641 for the next generation ... when a small number of parents generate a large number of offspring, with both estimations assuming neutrality of the markers However, a surprising result was that estimation of effective size...
Ngày tải lên: 14/08/2014, 13:21
Designing & evaluating an English reading test for the non-majors of Civil Engineering at Haiphong private university
... 5.Design of the study The study is composed of three parts: *Part I is the presentation of basic information such as the rationale, the scope of the study, the aims of the study, the methods of the ... Chapter two: Methodology 2.1.A quantitative study 2.2.The selection of participants 2.3.The materials 2.4.Methods of data collection and data analysis 2.5.Limitations of the research Summary Chapter ... use of authentic texts and real world tasks may be developed.’ (Mc Namara, 2000: 16) One of its distinguishing feature that supersedes other types of tests is that besides systemic features of...
Ngày tải lên: 07/11/2012, 14:12
Designing an esp syllabus for the second-year students of library study at the national teachers training college
... Furthermore, students at University of Cultures are of higher level of English proficiency than that of the students at NTTC And the target students at NTTC are lower in comparison with that at universities ... get that kind of information it is essential to ask questions about the target situation and attitudes towards that situation of the participants in the learning process Hutchinson and Waters ... common features of ESP in general and of ELS in particular 3.3 Cohesion Halliday (1997: 4) states that the concept of cohesion is a semantic one, it refers to relations of meaning that exist...
Ngày tải lên: 07/11/2012, 14:36
An english-vietnamese cross-cultural study of keeping face at the first encounter
... encounter 25 Situation a To business partner of higher status in the office b To their business partner of equal status in the office C To their business partner of lower status in the office PPSs ... occupation? (He/she is at your age and the same gender) a He/She is of higher status: b He/She is of equal status: c He/She is of lower status: To a business partner who is of higher status, ... business partner of equal and lower status This means that a business partner of higher status is paid more attention and achieves more respect than a business partner of equal or lower status This...
Ngày tải lên: 07/11/2012, 14:54
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... booths, eat off his plates and silverware or put their “thick greasy lips” over his glasses Gates’s satire arouse in the way he described the death of Carl Carl died because of a heart attack in ... aftermath, led the American to the golden age of booming national prosperity with the highest standard of living in the history of the world economy, as indicated in the increase of the Gross National ... narrator who knows everything that happens or a limited narrator who is the outsider of the events and describes from the points of view of one character in the story.) - Theme is the message of...
Ngày tải lên: 07/11/2012, 15:01
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3
... study will improve current situation of English culture learning of Tourism students at HCC 1.3 Scope of the study The focus of the study is on the corporation of English cultural elements into ... aspect that occasionally emerges as a topic of discussion is the relationship between knowledge of a foreign language and knowledge of the culture It is likely that the question of “culture” is often ... and that cultural patterns are interrelated and tended mutually to support need satisfaction * Goal = Exploration- The student can evaluate a generalization about the target culture in terms of...
Ngày tải lên: 07/11/2012, 15:06
SOME SOLUTIONS FOR THE DEVELOPMENT OF CONSUMER LENDING AT TECHCOMBANK HOANG QUOC VIET
... questions: What is consumer loans and its related features? What is the current situation of consumer loans at Techcombank Hoang Quoc Viet? And what are the reasons for existing limitations? Luu ... retail group Especially at this time, Vietnam is a destination of corporate banking, retail giant corporations • Element of law: The State has enacted legislation with the aim at developing a sustainable ... The orientation of the branch: expanding, strengthening and improving the operational efficiency of the office agency To attract more customers, the branch concentrates to the expansion of lending...
Ngày tải lên: 25/07/2013, 11:20
FATTY ACID COMPOSITION INCLUDING TRANS FATTY ACIDS CONTENT OF SELECTED VIETNAMESE INSTANT NOODLES
... that saturated fatty acids with chain length of C12:0-C16:0 are atherogenic, stearic acid is neutral, and oleic and polyunsaturated fatty acids have a lipid lowering effect Total saturated fatty ... polyunsaturated fatty acids * TFA: trans fatty acid* MUFA: monounsaturated fatty acids negligible proportions of trans fatty acids, bothwith monounsaturated and polyunsaturated fatty acids These ... The data obtained in this study, had shown the fatty acids composition of selected Vietnamese instant noodles The results show that the amount of trans monounsaturated and polyunsaturated fatty...
Ngày tải lên: 28/08/2013, 16:28
Investigation of thermal effect on exterior wall surface of building material at urban city area
... heat (total heat/solar radiation) of each material was calculated and analyzed (Figure 10) Figure 10 Normalized heat (total heat/solar radiation) using average heat of convection (qconv), heat ... normalized heat which is defined as heat of convection plus the heat of radiation and divided by the average of solar radiation The total heat results showed that the amount of heat would increase ... of heat into the atmosphere The normalized heat for granite and white concrete tiles were relatively same, due to identical specific heat for both materials It is expected that the capacity of...
Ngày tải lên: 05/09/2013, 15:28
Physicochemical properties of polluted water of river Ganga at Varanasi
... determination is useful The value of Phosphate varies from minimum of 0.005mg/L (Jan) at Shiwala Ghat to maximum of 1.58mg/L (June) at Raj Ghat significantly lower phosphate content was recorded at ... expression of the ability of water sample to carry an electric current The value ranged from maximum of 843µs (Jan) at Raj Ghat to minimum of 185µs (July) at Shiwala Ghat 3.10 Nitrate It represents ... represents the end product of oxidation of Nitrogenous matter and its concentration may depend on the nitrification and denitrification activities of micro organism The concentration of microorganism ranged...
Ngày tải lên: 05/09/2013, 16:11
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
... arts; patterns of living; and, a total way of life are five meanings of culture identified by Nelson Brooks Patterns of living are when and what they eat; how they make a living; the attitudes ... ideas of others rather than express their own opinions Another cultural aspect is that of the students’ attitude towards learning “Learners’ attitudes have an impact on the level of L2 proficiency ... knowledge offers a range of distinct options and patterns related to different areas of everyday life So students not only get information about cultures, but also practical use in appropriate situations...
Ngày tải lên: 07/09/2013, 13:00
The Use of Selected Medicinal Herbs for Chemoprevention and Treatment of Cancer, Parkinson’s Disease, Heart Disease, and Depression
... damage of DNA; (2) oxidations of unsaturated fatty acids in lipids; (3) oxidations of amino acids in proteins; and (4) inactivation of specific enzymes through oxidation of catalytic cofactors ... compounds The extent of protein oxidation was measured by determining the loss of tryptophan fluorescence and formation of protein carbonyl compounds, and that of lipid oxidation, by conjugated diene hydroperoxides ... heart beat or loss of rhythm is a common heart arrhythmia that can occur with or without heart failure Atrial fibrillation, often describing the heart as a bag of worms, begins as a loss of atrial...
Ngày tải lên: 25/10/2013, 05:20
MEAN TEENS- Prevention of social aggression at school
... individual or group with threats of violence or physical harm • Intimidation- Face to face threat that causes fear or public humiliation • Exploitation- Taking advantage of a weaker peer and taking ... “MEAN TEENS” Date: _ What is Social Aggression? Worksheet for comics What you think the point of this comic is? Give this comic a title It is humiliating and shaming a peer • What is mean ... a positive way of dealing with the situation: Creating a Peaceful School Name: “MEAN TEENS” Date: _ Worksheet for comics What you think the point of this comic is?...
Ngày tải lên: 26/10/2013, 19:15
Shaking a box of sand II – at the jamming limit, when shape matters
... out that, at least within a dynamical cluster of radius n 2/3 [34, 35], the orientational displacements of each grain are fully anticorrelated Figure 8.2 shows that the orientation correlations ... 110 When shape matters at the jamming limit Fig 8.4 Plot of the normalised probabilities 212 p(C) of the configurations of a column of 12 grains in the zero-temperature steady state with = 1, against ... complete absence of frustration and a single ground state of ordered grains, as obtained there For irrational , no local field h n can ever be zero (see (8.2)) Noting that irrational values of denote...
Ngày tải lên: 01/11/2013, 08:20