... thickness In some cases, a processed seismic line can delineate changes of the facies within a formation by changes in seismic wavelet amplitude Also, seismic reflection data can show features such ... have higher GR responses The Mount Simon has high porosity and some portions have an abundance of potassium feldspar Sedimentary structures include planar lamination and cross bedding (Saeed and ... such as formation heterogeneity, oil and gas prospects, and structural features such as folds and faults Many faults have been identified and mapped in Ohio Some of those were identified and located
Ngày tải lên: 01/11/2022, 23:19
... future data census and assess exposure to all workers in France regardless of sex and worker status (salaried and self-employed) Although only results on night work are presented in this article, ... exposure to night work at a detailed level The JEMs are easy tool that help assess exposure especially when information is not available such as night work JEMs present some limitations such as ... censuses with the 2008– 2012 JEM For each of these censuses, as presented in Fig. 1, the exposure assessment to night work was undertaken in two consecutive steps First, the assessment was based
Ngày tải lên: 29/11/2022, 00:19
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx
... carb-rich plant food: grains and starches You should avoid grains and starches as much as possible - which , unfortunately , isn ' t easy sources of carbohydrates in our diets Because grains ... was a shot of wheat grass These days , products such as ProGreens, PaleoGreens, and Greens+ are good sources of important nutrients such as chlorella, ju st to name a few that you may have ... oil, flaxseed oil, and butter CARBOHYDRATES Ideal sources for gaining muscle: all fruits and vegetables, including sweet potatoes and yams; oatmeal; and quinoa Ideal sources for losingfat:
Ngày tải lên: 22/03/2014, 16:21
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc
... came across this book, that's probably why Each article I write is typi-cally seen by tens of thousands of readers, and some articles have generated hundreds of com-ments, as well as discussions ... makes his muscles bigger and stronger, that's fine- as long as the athlete keeps getting faster The three groups I've just described-lab rats, gym rats, and performance rats- don't talk to each ... have Your basic understanding of the process is as simple as a first-grade reader: "See Joe's muscles See Joe flex his muscles Flex, Joe, flex! Watch Joe's muscles get bigger Grow, muscles,
Ngày tải lên: 22/03/2014, 16:21
Research " SUPERVISOR''''S MANAGEMENT STYLE AND EMPLOYEE PERFORMANCE APPRAISAL SATISFACTION IN A PUBLIC HEALTH AGENCY " pptx
... effective appraisal systems, assessing employees’ reactions to various aspects of appraisal systems, and the social context variables that can impact performance appraisal systems This type of research ... Table 13 “Appraisal Satisfaction - Sample” Table 14 “Appraisal Satisfaction - Supervisors and Non-Supervisors” Table 15 “Appraisal Satisfaction - District” Table 16 “Management Style Means” Table ... appraisal technology Appraisal reliability and validity still remain major problems in most appraisal systems, and new (and presumably improved) appraisal systems are often met with substantial resistance
Ngày tải lên: 23/03/2014, 05:23
Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment
... the data in the Trang 19Populating DataSet-Manual1 Construct your own DataSet (schema) 1 Create Dataset 2 Add DataTable(s) 3 Add DataColumn(s) to DataTable 4 Define datatable schema 2 Fill Data ... into DataTable(s) in DataSet 1 Add DataRow to DataTable 2 Processing data in dataset … Dim ds As New DataSet , r As DataRow With ds.Tables.Add("SV") .Columns.Add("id") Columns.Add("Name") ... Creating DataAdapter Objects Create DataAdapter using Wizard Create Typed Dataset Fill dataset, display in Grid User change data in Dataset Update change to database from dataset Trang
Ngày tải lên: 13/05/2014, 12:19
Báo cáo hóa học: " Research Article A Hardware-Efficient Programmable FIR Processor Using Input-Data and Tap Folding" doc
... architectures As illustrated in Table 1, whenW equals L, architectures in Figures2(a)and (sub-)data and (sub-)coefficients They both also have Booth de-coders and accumulation paths with the same hardware ... carry-save adders of the post-processing unit Finally, the vector merge adder (VMA) is used to sum the carry and sum values to derive at a final re-sult 4 ANALYSES AND COMPARISONS OF PROPOSED AND ... operamultiplica-tions are performed on input subdata at the same precision index and the coefficients correlated to these sub-data Results are then added, and the shifting and accumula-tion operaaccumula-tions
Ngày tải lên: 22/06/2014, 23:20
Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx
... abuse, as well as personality disorders This is not peculiar since most classic animal models are in essence post-traumatic stress models and most biological psy-choendocrinological markers are ... problems, multiple separations or divorce, alco-hol and drug abuse, gambling and sexually transmitteddiseases such as AIDS Behavioural disorder Logorrhoea refers to pressured, excessive and not alwayscoherent ... nor-mal (suppressors) and pathological (non-suppressors) Longer protocols requiring higher dosages for dexame-thasone and a 24-hour assessment have also been sug-gested The test presents a 67% sensitivity
Ngày tải lên: 08/08/2014, 23:21
Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps
... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopha-ryngeal ... interests Authors' contributions FS is responsible for data acquisition, literature research and writing of the manuscript ES is responsible for data acquisition, statistical analysis and writing ... 21 Mazonakis M, Zacharopoulou F, Kachris S, Varveris C, Damilakis J, Gourtsoyiannis N: Scattered dose to gonads and associated risks from radiotherapy for common pediatric malignancies: a phantom
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Statistical methods for detecting and comparing periodic data and their application to the nycthemeral rhythm of bodily harm: A population based study" ppsx
... residuals) The data are also tested for stationary cycles by a Canova-Hansen [41] test and a Kwiatkowski-Phillips-Schmidt-Shin test [42] We also divided the data in 10 disjoint random subsamples ... frequencies the data are modeled as a sum of sine and cosine oscillations and a Fourier transform is performed In our case the Fourier transform equals an ordinary least squares All frequencies are tested ... large sample sizes This can in some cases increase the tests power In addition the method allows a simultaneous comparison of several time series This allows to test the hypothesis if “at least
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Effect of children’s shoes on gait: a systematic review and meta-analysis" potx
... of shoe investigated was attainable, the term ‘unknown’ was used Statistical analysis Meta-analysis was undertaken of homogenous studies where appropriate data were attainable Mean differ-ences, ... axis’ maximum tibial acceleration; decreased rate of tibial acceleration; and decreased shock wave transmission as a ratio of maxi-mum tibial acceleration However, Alcantara and collea-gues [21] ... 25%, a random effects model analysis was used WhereI2 was less than 25%, a fixed-effects model was used When necessary, reported measures were converted to dard units, and standard errors were
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf
... these results by ascertaining the preva-lence of psychiatric disorders in a large epidemiological study using detailed standardized diagnostic assessments The aim of this study was to assess the ... of both academic and public interest The aims of this study are to: a) assess the prevalence and risk factors for common mental disorders and post traumatic stress disorder (PTSD) symptoms, during ... participants The response rate was 74.2% and the adjusted rate was 75.8% The characteristics of study responders (Additional file 1: table S2) Uni-variable analysis of responders and non-responders
Ngày tải lên: 11/08/2014, 17:20
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
... SIF 2 AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA 2 I F P S : 83 : 83 : 83 : 83 2 CATACTGGTAAAGCTTTTATTGTTTTCTATCATTATAATAGCTCTTTTTCTTTTTTGCTTATTCTTTGGTCTGATTCTTTGGA ... G A C A T A C A T A T T C C A T C A GAGACAAATGTTTTCCAT A ATAGCA GAGACAAATGTTTTCCAT G ATAGCA GAGACAAATGTTTTCCAT A ATAGCA GAGACAAATGTTTTCCATGATAGCA I F P S Os.55011.1.S1_x_at (LOC_Os01g20120) A
Ngày tải lên: 12/08/2014, 03:20
Ele ctricity Use d by Office Equipment and Netw ork Equipment in the U.S.: Detailed Report and A ppendices ppt
... assuming that the average lifetime of copiers is years We did not need sales data for displays, because we assumed the stock of displays is same as that of desktop computers Table A- 2 shows shipments ... peripherals associated with minicomputers such as external discs and tapes Based on sales data, we assumed that the IBM AS/400 is a representative minicomputer machine We estimated the average power ... on assumptions, there are significant uncertainties Notes on Displays and Terminals We assumed that the usage for displays and terminals is same as that for desktop computers Notes on Commercial...
Ngày tải lên: 23/03/2014, 23:20
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... regional missions in a particular geographic area 20 missions missions missions Support a program of assistance in a particular country regional missions Support a program of assistance across a number ... across sub-Saharan Africa USAID officials told us that grantees may pilot innovations (see sidebar) or work in a country s most rural and hard-to-reach areas Also, in certain cases, grantees raised ... Technical Assistance • The bureau managed a program for anemia reduction and vitamin A supplementation in the states of Uttar Pradesh and Jharkhand • The bureau assisted Indian state governments and...
Ngày tải lên: 28/03/2014, 09:20
Tài liệu Editing and Updating Data in a Web Forms DataGrid pdf
... CreateDataSource( ); dataGrid.DataKeyField = "Id"; dataGrid.DataBind( ); } private DataTable CreateDataSource( ) { DataTable dt = new DataTable(TABLENAME); // Create the DataAdapter and fill the table ... SchemaType.Source); // Store data in session variable to store data between // posts to server Session["DataSource"] = dt; return dt; } private DataTable UpdateDataSource(DataTable dt) { // Create a DataAdapter ... CreateDataSource( ) This method fills a DataTable with the TBL0705 table and stores the DataTable to a Session variable to cache the data source for the DataGrid UpdateDataSource( ) This method creates...
Ngày tải lên: 26/01/2014, 10:20
Tài liệu Data and Information on Women’s Health in the European Union docx
... men and women in society 31 32 Health Issues 33 Cardiovascular Diseases Diseases of the heart and circulatory system (called cardiovascular diseases or CVD) are a main cause of mortality as well ... For All Database (HFA), European mortality database (MDB), Alcohol control database, Tobacco control database, - various reports and publications from organisations working on specific women s ... well as disability and morbidity among women in Europe CVD is caused by disorders of the heart and blood vessels and includes coronary heart disease (heart attacks) and cerebrovascular disease (stroke)...
Ngày tải lên: 12/02/2014, 23:20
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... Pro transmission scanner (Epson, Nagano, Japan) and analyzed with imagemaster 2d platinum software, version 5.0 (GE Healthcare) Spots were detected automatically by the software and manually refined; ... proteins was able to correctly cluster them in the two classes described above (data not shown) Statistically-significant (P < 0.05) functional association with GO classifications was obtained from ... present study could represent a valuable starting-point for focused investigations aiming to better understand the key issues of PD pathogenesis Materials and methods Cells Human neuroblastoma SH-SY5Y...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... EWS for binding to G-quadruplex DNA (A) EMSA was performed with EWS (lanes and 4) and 32P-labeled ETS-1 (lanes and 4) or ssDNA L (lanes and 2) (B) EMSA was performed with EWS (lanes 2, and 6) and ... and visualized by autoradiography acids, was expressed in Escherichia coli as proteins fused to glutathione S- transferase (GST) and purified using glutathione agarose 32P-labeled ETS-1 was first ... CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 reverse d(CGC TCG AGT CAA TCA AGA...
Ngày tải lên: 15/02/2014, 01:20
Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx
... included questionnaires, detailed physical and ultrasound examinations, behavioural observations, and biological samples Assessments in pregnancy were performed in each trimester Assessments in the ... conception and the first year postnatally Air pollution exposure estimates were assessed for the different prenatal and postnatal addresses There can still be non-differential misclassification of air ... information on spatial contrasts in air pollution exposure is required, since ambient air pollutants display significant smallscale spatial variation This intra-urban spatial variation has been documented...
Ngày tải lên: 06/03/2014, 19:20